Description :
From Genome Similarity Track
Location :
Scaffold_1370:38- 1870
Transcript NameFunction/comments
Phymu_g13180hypothetical protein

Sequence
1832 bases(100 bases per row)
TTCAAGAACACGGTCGCGGTAGCCAGGTGTGCCGGGGTCAAGGGCGAATTTGTCCGGAAGAAAGAGCATCATGAAGGCCACGAGaagcttcaccttcgac
cGCTGTTGTTTGGGAGGTTGTGTCATCCATCGCGGCTCCTGCGCGTACCACGCGAACCACGCCGTGTTCAGGTATGTTACTGATCCTCggtgctgtttct
tcttcgaagcACTGACTCCTGTCGTGTCTTGGTCTTCACAGCTCCGCTTGTTTGTTGTCTTTATAGAATCGTTGCTCTGTTTAGCCTCGAGCGCGTCCAT
CCGTGCATCCTGCCgcttgatgagctccatAAAGTGCTTAATGACAGCCGCTTGGTGATCGATGATCTTCTGTTCGTGGGTTGGTGTTGTTGGCTTCTCG
TTCTGGTTGATGGAGTGTGTTTCGCTTCGTTTGATTGCTTGACAGGTAGCTGGGTCGCGAGCAAGGTGCGACGACCATGCCAGTAGGCCAGCTGAAGAAC
ACTTGGCATGACTGACGGCGACGTCAACGCGCTTGACGACCTGACTGTCAGCCCTCAAGGCCTTTAGCATCGGAAAGTAGCATATCACACGCGCGGTAAG
TACATCGAGTACCTTCTTGTTAATGTTGTAGCTTTCTGTTTCCAGCATGTagcagaacgagaagagAACACGCTGTACCCCCCAGATTGAGTTTGCGCGT
CGAAGCTTGACAGGTCCTGCAGAGGCACTGCATTCCTCGGTTTGTATCCGCTAAGCACCTTCGCAATCCTGTGGTCTTctttgctggtgttgaagatgtA
GTTAAATCCTTTGTTTGTTGTGCTCATGTTCCAGGAGCCCCTGTCGAATATCCAGCACGCCGTCATCTCGTCGCAGTCATTCGCGTGCTGAGCTCCTCCG
CGCCGGAACGAATAGGAAGTCAAGGCAGCGTCtactccagcagctcgagcgacgCGATCCAAGACGCGGTTGACGTGCGCGTAGATCGTGGGTGCCGTGT
CATTCCGTTTAGGTGCGGCAGGAGCGGCAAGGCCTGCAGGGACCGGAGGTGCgttcaagagctccagtagcgGAACGTCCGGCGACAGCGTGGCGGTTGT
GAGGGTTGCTTGCTCGGGGAGGTTACCGACCAGGGCAGGGCACGGTGCAGCTTGAGACGCCAGAGCCAGAGCGATGGCGAGTACGGGGCATGTGGCGAAA
TCGGTATCAGGAAAGAGCGAAAGCCCCTCCTCCTCAGATGTCTTGACGCGAATCAGCCGCAGGAAAATGACATTTGACGCGTCGACGGAGATGTTCCTCT
TGTGAACCATCGCAAGGTCAGAAGCGCGGCCGAGGAGGTACCACAGAAGAcagagaagagcagcgtcttggtaATCGCTTTCAGAACATGCATAAGTATA
CAAATACAGCAACATTTTTTCAAATCAACCTTTGTACATGGTATAGCTTTCGACACAAGACCCCCACCATCCCTCTTCATACAGAAGTTGTCTAGTGTCT
TTCCCATTTTCAGCAGCCGAGCTTCTAAAGAAGCTCGATGCTTAGGGAACTGGTCAAGTAGCCACAGCTTAGCTTGCCGATAGTACTGCATCGCAGTGTT
GCGAGCTAGTGGCTTACCCTTTTTTCCTTTGTTAAATGCAAGATACATACCAAACTTATCCATCACAGAAACAAAGCTCTTACCACTCTCATCTCTATTA
ATGCATGCTCTTACGTACTCTtcatcgacttcttcttccttcagAAACTTAGCAAAGGCTGCAATAGCTGTTGCCTTGGCACGCAACGTGTTGCCAGGCT
GCAATTCGTCAAGCCCCATGGTTCGGGTCCGA