Description :
From Genome Similarity Track
Location :
Scaffold_3378:38- 1846
Transcript NameFunction/comments
Phyta_totarag15251hypothetical protein

Sequence
1808 bases(100 bases per row)
TCACGATGCTCACGTTGTGCGCGTCAACACCGTTCGTAGTGCTCCACGCAGATTGATCATAGATCGTAGCTGCCAACGTTGAAAAGTCTTTGTCCCAAAA
TCCACACGTATCCGATTGTTTGTTTGTACAATACACGGACGAGATCTGTGCGTTGTCGATAGTCGTAAGTATCTTTGCCTGGCCGCCGATCGATGGCGGC
GCGTTCAAAACGACGTCGTACGTGGCACCTGTCGAATCCCCTTCACTAATGTCCAGCGCAGCGGTAGAAAGCGTGACTCCAGGATCATTGTCCCAAATAC
TCACATCGATGCTGTTCCCATGAACAAAATTCGCCATACCGCAGTTCCACGAAAGCCGCTCGAGCGAGTAACTCTGCGGGAACATCACGAAAGTAGCATC
AAGCACACGATCCACGTAGCCTGCGGGCCATTCTTCGAACGCCCAGCGCATGGTCTCTAGTCGTACTAAGCCAGCACAAATCGTATGTAGGACATTCCTC
GGGTTAGTGCTCATTTTTTGAGCCTGGCCAACATTCATGAGCCCAAGGAAACTCAGCACAAAGCCTCGTAACTCAGGTGGCGGTGCCACAAACTCCACCC
CGAAGGTGGCGTTGGattctgaagctgctgataGAGCTGTGAGATTGGAATCGCTTTCTTCAGCCTGCAACAGAGCGAGAAGGGTTGTGTAGCTCATGTC
TGTCGGAGTTTCCTCCGTGTTTCCAGGATCTAGAGGCAGACTGCCAAATCGAGCTGGAATTCGTCCAGTATCGGTCACCACGTTGGCGATACACGCGCCA
TTGCCGAGTGAAAAGGAGCACTCGTTCGAAATATCACACACTCGGACAGAGGTTTGACCCTCTTGAAGCTCCTCTTTGGCTACTAGACAGACAGAAGACT
CCAGCGGGTCGCAATTCGCCACGTCAAAGCATCGAGGGCGACGGGTATGGTATCGAATATCCTTGCTCTCGGTGTAGTGAAGCAACGAGCCTCCGTTATA
AAGTCCACCGTACTCCACTTCGGACTCGACATCATCCACGGCACTCACCACCACACGCTGCGGCTTATCCCAAGTTTCAGGCTGGAAGACGAGCACAGCG
GTGCCATCTTGCGTAGCTGTACTGGAGGATTTCGGTGCTACGGCTGCTTGGTGGGCATGCAGAGGCATCGTCACGACCTTGACGGGATGCCACGGCCGGG
ACGTCAGTACAACATCGTAGCTATCGTttccaccaccttcagctACAAATACGTGCTGTCTCGACAGTGATACCCCGGCTcggtcgttgtcgtcgatcTG
CACGGTAACATTACGCCCCGTAAGAAAAGGAGTCTCATTGCCATCAAAATTCGGGTCAGCACTGGCCACAGAGTGCGCCACAACGGCGTAGTGCCTACCT
TCGGCCAGTGCGTCGTCGACCGCTGTTAGACGCACGAACTGCTCGCGGTTCCAGTTTGCAGGTGTGAACACCACGCGCTGCGGCGTTAAAaattggagct
gctgaatgaGTTCGCCACTCTGGTCCGGGAGCTGCACGTCTTTGGCTTCTACGACGACATCCGCGAGCGGCTGGCGGTTTAGCACCACGGCGTACTCTGC
AACCAGGCCTCCTTCCCTAATCCGCCGTCTTCGCGGTGTCAGCGTCACTCCCCCGTCCATGGCATAGTCCAAGATATCTCCGCCAAAGCTCAGACCCACC
GCGAAGTTGTACGCTCGGTTCTGCGCGCTGGTCCGCGCTTTCGGGTCCATGATCTGCGCTTCGTAGTCGGACAGCACTCCAGCGTGTGTCTTGGTCTTTA
GAATCTCT