Description :
From Genome Similarity Track
Location :
Scaffold_361:38- 18083
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_361-snap-gene-0.8Mitochondrial Carrier (MC) Family
Pytve_DAOMBR484maker-pve_contig_361-snap-gene-0.14Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_361-snap-gene-0.9Flagellar protein
Pytve_DAOMBR484maker-pve_contig_361-fgenesh-gene-0.650S ribosomal protein L13
Pytve_DAOMBR484fgenesh_masked-pve_contig_361-abinit-gene-0.31Glycoside hydrolase
Pytve_DAOMBR484maker-pve_contig_361-fgenesh-gene-0.3GTPase
Pytve_DAOMBR484maker-pve_contig_361-snap-gene-0.13Dynein heavy chain

Sequence
18045 bases(100 bases per row)
CACGAGCATCTGCATGGTGCTGTACGAGCCGTTCCGCGACCTGTTCGGCGCGCAGGGGTCCAAGGGCGAGGTGCCCTTCGTCAACAAGTTCCTGGCCGGA
GGACTGGCCGGCGCCATCGGCATCTCGTTTGCCAACCCGTGCGTTTTGCGTTGATCTGCTTGATGGAAAAGGAGGGACATTGGTGGCTCATGCTTGTGGT
GGTGGTATGTATAATGCGGTCAGGGTGGACGTCATCAAGGTGCGCATGCAGGCGGACCGAGCCGGCACGCTGTATCGCGGCGTGGGCCACGCGTTCACGA
CCATCTACCGGCACGAGGGTCTCCGCGGCTTCCTTCGCGTACGTGGCAGCATATGCAACGAAAGGTGTTTTGCACGTCACTAACCTCCGTCGCTGCTGGC
TGTGAACAGGGAATGCCGCCCAACATCCAGCGCGGGTTCGTCGTCAACGCTGCCGAGCTCGGCACGTACGACCACAGGTATCAACAGACCCACACTCGTT
ACAGTGTCATTGCCGAAGCGAGAGTCACTAATGGTTGGATGGATGGATGGCTTGGCAGCAAGGAGATGCTGATCTCGTCGGGACTGCTCCCCGACGGCGT
GTTCGCCCACACTGGCGCGAGCTGCGTGGCTGGGTTTGCTGGCGCAGCCGCCTCCAACCCGATCGACGTCATGAAGACGCGGCTGATGACCCAGCCGACG
GACGCCCACGGCCGCGGCACGCTCTACAGCGGCATGCTCGACTGTGCGCGGAAAACGTTCCGCGAGGGCGGGCTCGCCGCCTTCTACAAGGGGTTCGTGC
CCAACTGGATGCGCAAGGCTCCGTGGTGTGTGCTCTTCTTCGTCACGTATGAGAAATACCGCGCCGCGCTCAGTCCCGACGGCGAGCTGTGATATGTGTC
AAATCTGCACTGAAAAAATAGACCTCTCTCAGCGTTGTTGCGTAGTCATGATGACGTCCTCCATAATCAACATGTCACGACAGCAGGAATCCTCAATGGC
CTGAACTAGATATGGATTGAGAACTAGATATGGGTTGCATGGCGAGAAGGTCGCAGCGACAGCACAGGCGTGTGACTCGTCAATAAAATAGGGTATCTAC
TTGAACTGAGGAGAGAGATACACACGCGCATCTTTTGTTGCTTCCAGGATCAGTCGGCGGTCAGCGAGAGACACGTGCAGCCCGATCTCTCGATGCGCTC
GCTCCCTTGCCGCCGTCATCATACATAACTGCCCGACGCACTGCTTCTGCTCCGCGGCATGCAAAATCACTTGAAATCGACCATAAATTAGCGCCGCCGG
CAACTGACTGGCCAGCGGCCGCACCCGCACCCGCCCTCTCCTTCAACACTTAACGTTGTCGAAGTCGTGTTTCTGGATCGTCCACGTCGACCGCGGCGGC
TTCAGGTAGTGCACCTGGCTCGGGTCGAACTCGTCGCCAGCCTTGTGCTTCTCCTCCTCCTCGGCGATGTTGGCCAGCAGCTGCTCGCGCAGCCCGGCGT
GCTCGCCCGTCATCGTCACCTTCAGCTTCGGGTTCTCCGCGGGCGACGACACCTTGCCGCTCTTCGGCAGCATCACGACTGGCAACTGCTCCGGGATGCG
CTCCTCGTTCGACCACCGGTCGCGCGAAATCACATGCACGTTCAGCGCGCGCGAGAACGAGCCGTTCATGAACCGGTTCGAGATCGTGCTCTCCACAGAC
TGCACCGGCGCGTCCTCTTCCTCGTCGTCCTCCGAGCAGTAGAACGCCGGGCCGCGCCGTCGACGACTGCTGCCGGTGCCGCTGTTCCGCGACAGCACGC
AGCGGCGGAACTGCTCGCGCTCCTGGCGTCGGCACTCGAGAATCTCCTCGCTCGACAAGCGGTCGCGCTCGCGGTCACTCGCACCCGTCGCAGGCGCCGC
CGTCGACGTTGGCACCGGCATGTTCGCGGCGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCTCGTGCGCGCCTTGTTCAGTGACTTGA
GCAGTTTCTGCAGCGCCACGAACGTCTCGTCCACCTCCTCGTCCTCGTCCTCGGGCTCTGACGCCGCCGACACCTTCTTCGCGAGCTTGCTCCCGTACCG
CGAGGTCCGCGCCGACATCTTGCCTGGCTTGGGAGAGTTGCCTGTCCCTCGCCCCTCACCACTGGTTACGCTGGCCGCTCGCTCGGCTATTGGGTAGTGC
GCGCTCCGCTTGCTTCCTCCGGGCGGTCGGCCGCCTCCACATGTAAGGACAGCGCCTGCCCTGCCACACACACACACCCACACAGATCCGAGAGCTCCTC
CCCAACGGCGCCGATGACGCTTTCTGGTTGTGAACCTGCACGCCAAACGGCCCGAGGTGCGCGCGGCGCTGTGCCTCGACCTTCCACCCGGTCGCCTGAA
CAGAAAGGGGGAAGGAAACTGGGAATCTCACACTGGGGCCACTGGCCTGCTCACCGACATGGAGCGGCCCATCACTCCGCTTAACCGTCATCAATCAAGT
TTCGCCGGGGCTGCGCGACAGCAGCTGGACTGAACTGTTGAGCGCCAAAAATGGCAAAACAAGGTATGATATAGTGCGGTGTCGATAGTGAATGTGTGGG
TGATGATCACTAATACAACCCTGTTTTGGGACTCATTCGCTGCGGCATGTGGCGACCAACTCATATCCTTTCGCGGGTAAATCATATCTTACAGGGCTGA
CGCTCAGAGCGGATATTCTGCGCAACCCTACCACCCACCCGTCTGAAACGGTTAGGGTTGCCGTTTTTGAGCAGCCAACGGTCACGAATGGAACCTCGAA
CTGGAAGTTTTCCGGACCTTCCGTAATTTACCATCTCTTGACGTTGGTAACGGCCGCGAAGAGCCACGAGCCCAGCTCGACACGCTTGTGACAGCGGCTT
CCGCAGCCACACCCACACGGTGCGGCACAGCAAAAAGGAACAGACCGCCACAAGTTTCGTTCTCGGCCGGTGTGACGACTGCTTCTCCGAACTGCGAAAA
ATGTATAGACCCGTTCGCAGCATGTTCATGGGGCGAGTGCGCGCCTTCCCATCCATCACGCAACGCAAGCCCAGCGCTGGCGCGCGTGCTTCAGACTTTC
CTACTGTATTCTGCTGGTCGCCTGCGCGGCTGGACGTGGAGGCCCCGCCAGGTGTCAGTGTCGACGCGCATCATCGGCGCAGCTGCGTCTCCGAAAACTG
CTGCGAGAGGATTATCCGGACGTATACATCCTGCGTGCATGGTAGGCTGGTTGTTTTTTACGAGACAGAGTGATGGTCCCAACTTCAACATCCCCTCGGA
ACAGGCGCGGGCGATCGCCCGAATGGTCGCGCCGTGCCGCCTCGGTGTATGAGCTGAGAGCTCCGCCGCGACTCGAAGGCGCGTGAATGCCCGTCGTGGA
GCCGCAGCCATGGCGGACCTGCTGCTCTTCTGGCTCAACCACGAGCTGCAGCTCTCGACGGTCGTGACCAACATGGAGACGGACTTTGCCAGCGGCTACC
TGCTCGGCGAGGTGCTGCACCGGCTCAACCAGCAGCACAACCTGGAAGATTTCGTCAAGAGCGCGAGCGCGGACGCCAAGATCATCAACTTCTGTCTGCT
GGAGCCCACGCTCCGCAACATGAACATCAAGTTTGACGCCAACACGGCGTCGGCGATCATGAACGAGGCTCGCGGCGCCGCGGCCAACGTCCTGTATCAA
ATCAAGGTAAATGGATGAGCTCAGATGTTGGCATTAGATGTGATAGATGGATGGGCATTGTGACAGCGGATAACACTTTGTGCGTGGGGTTTTGCGCCAG
TAGATGGCTGCAAAGAGGATCCAACGCGCTCCCGTCGTCTCCACCAAGTCGTTCGAGCAAACCGGAGTCATCCCTCTGCACAACCGACCGGTGAAGCTAC
CCAAGCCCGTCTTCGATGCGAGCAACCACCGCGCTTTCGAACACTCCATCCGACGGCAGGTGCACTCGAGTGGTGCTCTGCAGCGCCAAAAGTATGTGCA
TAGTGGGTGGATGAGCTCGGGAGAAATCGAAATATCGACTGACAAACATGGACATGCTGATCCACATCCAGAGACGAGATTGTTGAAGAAGCCGAGATCC
GCAAAGCGTACCGAATATCGCAACAAGAAGAGAAGGATCTTCTGGAGCGCACCAAGGCAGAACGGCTGCACAAAGCGTTTCTGCACAGCCAGTTTATAAA
AGAGGCGCTGAACGAGACGGACTCTCCAGCGTGGAGACAAGCACTCGAAACCAAGAATGCGCGAGAACAGAGGCGAGCAGCCTTTTATCGACAACTTATG
GCGAAACACACCAAAGCAGAGGTTAAACTGGAGTCTGCTGTGATGGTTCTTGAAGTCTCTGAACGACTGACGGGTTTGTGTATCATCAGGAGGATCGGCT
GTTCAGTCTCCGACGGACCGTCCGCGACGACCTCGACGCCTTTGATGTACGTCGCGGCTTCATGAATCGCGGCTAATCTTTCACTAACTCGACTGTGATT
GACAGCGCCAGGAAGCTGCGAAGGCGGGTGGCGGATCCAAGCCCTCTCTTTCCAAATCTGCAGGATACGGTCTGCGTTCTCTCGCAGTCACATTAGCCAA
GTCCAGCGACAACACTGACACTGCTGCTCCAACGGGTCGCTACGAGGATGCCTCTGCTGAGAATGCACGAGCTCAAGACTCGAAAGTAATCAAACAGCAG
AAACTTCAGCGGGATCGACGAAAAGAAGCGCATGAACGAAGGCGCAAGCGGTTCCTCCAAAATTGTTCTCTGAGGCACACCAACTTGTCAGGCGTACGCG
TGACGGCGATTCTCGAGACACTGACACTCCGCTCGACAAACAGTGAGAGGGAAGTCTGCGAAGAAATCGAACGCGTCGTATTGTACAAAGACATTGCCAG
AGAGAACAGGACGCTGCGATATCTTGCATACAACCGTCAGCGAGAGAACGATATGGCTGCGCGTATCGGATCCGACAGCAGCTTCTACCAGCTGCTTCTT
CGGCGTTATGAAGACGATGTGAACATTCAAGACGAAGAGCGTCAACGCTTGGAATGGGCTGTTGACGGCGCCGAGCATCACAACGCTGAGTCAATAGCCA
AGTGCATGATGAACGAAGTGCTCGACTTTGTTGTCTTCGCTGCAAGCAAGCGAGAGGACAGCCAGGCCTCTCGAGATTCGTCCGAGTTCCTGAATGGCGA
AACGTGGGCAGAGTATTGCGAGCTGTTTGCTGCTGGGAAATCGCTCAACCTCGACATTCCTGCTACTGATGATGACCGCAGCTTGCAGCTGACGGAGCAG
CATCAATTGCTGGATGCACGAGCATTTGACCGCTACTTGTCGGAGTTTCAACCTTCTCGCTTGCCTGGCGATTATGTTGGAGCAACAGCTAAAACGACCA
GTGTGTTACCCTGGCTTCCAAGTGACTCCAAGTTTGTTGGAGCAACTGACGTGCTAGAAGAATGCTTTGTGCTTGGAGAGGAGATCAAGTACTTGCGCTG
GATCAATCATACCATCCTCCCAAGCGATGTTGTGGACAACGAGGATGGGATACAAACAGTCAGTGATGCTCTACTAGCGACCGTTGTGCAGAGTCCACTC
GGTGATTTTGCCAACGAGTTGCGTATTGTGTTCTTCGGTCCGCCGTTTGCCGGGAAAGAGACCCAAGCAGCACTGTTGGCGCAAAAGTTCAATTTGGCGC
TGCTCTGTGCGCATCGGCTTCTTGACGAAGCGGTTGCTAACAAAACTGAGCTCGGCGTGCAGATAGAGAAGGTTCTCGCTGAAGGCGACAAACTGCCATT
TCAATTATACGCACAACTCGCTGTCGAAGCAATTCAAGGTATCAATCGCGGCACAGATGATCAGGCAGCTTCTGACGGGTGCACCTCAAGCACCAACAAG
AAATCGGGATGGATCTTGTATGGGTTGCCGAGTACAGAAGGACAGGCGATCGAGTTAGAGAAATTGCTGAGCGGATATGTGGATCCACGCGCAATTCCAT
CTCCGTACGACTTCGAGTCGCCTGTAGCGCCTGGCTGTCCCAAGCCGGAGCTTCCTGACACTTTTTTTCATGGCAAATCTGGCGTCGATCTGGTGTTTTA
TCTGCAGTGTGACGCTGCCTCTGCCACACAGCGATGTCTAGGACAAGTCGAGGATGGCGAAACTGGAGCGAAGTGGCACTTGCAGCACAATCCTCCCCCA
GAGGACTCAACCACTCGCCACCGCTTGCAGCATTCGAACCACAGCCAGAATGCGAGCGAGCTGCTCTCTATACAACTGCTGACACACTCAAAATGCGCGG
ATAACCAGAGATCGTGGCATTCAAAATTTGACACACTTCGAGAGGTTGACACAGTGACAACTCAGACCCCAGAAGGTGCACACGAAGCCATTGTCGAATA
TGTCGAGGGGTTCGTCCGCATCCAGCAGCAAAAGAACTTGTCTTGTCAGCAAGATCAAGAGAGCACCGAGTTGAACAACATGGTTGAAGAAGAGGCGCGG
CACGAGCGAATTCGCTCTCTTGATGCCGCGATCGTGAACGGACAAGAAGAGCTCGTCAGTCGGCAGCAGGCTTTGCAGCAAGCTGAAGAGGCGAAGGCCA
AGAAAGAGGAGCTGGTGGAGCTTCGAAACGCAGTCGACGCGGCTAAACAACACAGTGAGAAAGTCATGTTGAACGCCAACACATGGGTCGCAGAAGAGAA
AGCGATGCATGCTGAGGCTTTGAAAGTGTTTTCAGGGGATCTTCAACCAGAGCTGGCAAGATTGCTGGTCCAAACATGGAATGAGACGGAAGAGCAATAC
ATCTCGGCGATGCATCGCTGTTTCAGGCACATGCGGCTTCAACGCTCAGCTCTGTCCGAGCACACTCAGTCGGTGGTGAACGAGTTTTGCGCATTTGTGC
GCCGTCCTGACCGGAAGCAGGCGGCGATCAATACCTTTCAGCAACAATTCAACGAAGTGATCGATGACATGCGCTTTGACGACTCGACAAAGGAGGAACT
ACACGCGAGAACCGACATATTCCAAGACGACATGACCTCTCTGCTGTCCAACAAACGTGCCGAGAATGATGCCGAGCTGGTGAGCCTGCTGTCTGACGGG
TGGACAGAAGACGCCTGTCAGTCTATTGCGGCCACATATCAGCTAGCACTACAAGCCGAGTGCGATCGCTTCCGTGTATCCCTGCAACTGCTCGTCGATG
GGTATTCGGCATCTAGCAGGGATCGGTCGGATCTGTCGAGTTTTGTCGAGAATTTTCGAACGCAGCTTTACCGAGTGGACTTCTCGTGCCGGATATTCCG
TGATCCATCGGGCCAGTTGGAAGAATCTCCACCACCAGTTGCAGCGGCACCGCCGGCTTCGACGAAACCACCTCCGAAAGGGAAAGGCAAGGCAGCTGCT
GCGCATGCCGCGCCTGCAGCTCTCGCTCCCGACCCAATAAATGACGGGAATGGTGACCCGATGTCGATCGAGGACATGCAAGCGATGTTTGATACAGCCG
TTCACAAGTGCGAAACTTTTATTGGCGCGGTGCTCACAACACCGGCGGGATCTGACAGTCAGGACGCCAATACCACCGATCTCGGACAGAACATTTGCGC
TCTGAACCTTCGCAATGGTATCAAGTTTGAGCACGAGCTCATGCAGCGGCGAGTCCGTTCCCTGCGCGAGGTTTCGCTGGCTGCGAGCGACCAACTCAAA
CGCGCGATGAGGATGGTCGAGAACACTCTCCGCCAGGTTATTGATGATCGAAAGCGTCGTGAGGATGCTGCAGTAGCCTGCCTTATCCAGTACATCCGCG
CTACAATCGAGAACGAGACCGGGTTGCCCTGCTGGTTCAACGTTGCTGTGAGTGTTTTGCCTCTGCTTCCATGATAGTGTTCCCCTTACTGACTGCCTCA
CTGGAACTTGTGCATGTCCCATGCTGTATAGCCTCAGGAAGTGTACCGATTCCCCGTCACGGCGCACTTACTCGAAGATACACTCGTTGCAGTGGACGAA
AGCAAACGTCTGGTGCCGCTCGCTCCACCGGAAGAACCGCCAGTTGTCGAAGACACCAATGAACTGCAGCTCAGCACGCAACAGCGCGAACATCTGAAGG
CCACAATAGGCATCGGACCGCGCTCGTTGGTGCCGGTGTTTGAGTTACTCGAGGCCATCGAGGCCGCCTCTAGTCTGCCAGATGCGATGCCCACGATCTG
GCGCGAGTGTTCGAATGTGGTGTTCGCACAGGTATGACCACTGATAGGCAAGATGGGAGATCGTGAGTGGTTGACTAACTGCATGTCGTTGCGAGAGCAC
AGATCGCGTCCAAGTTCATGCGCAGGCAACCAGGCTTCGTCGACCTTGACGCTTTCCTCGACTGGATGTGCCAGAACGAGGGCGAGTTGCGCCGCATAGT
GGACGAGGACCAGCAGCCAGTCGACGTCCCAGTCGCTAGCACAGCGACTCGAACGGAAGAATCACCCGAGCACGCAGGAGCGATAGCTGACAAACCGCTA
GAAGCGGCATCGTCGTGAACCAAAGCTCTCGCCACACCAACAACCCACCACCAATTCAAAGCAAATACCTTTTGTCTATGGAACGTGTTCATCCTACCCT
CGGATACCTGCTTCGTCCTCCACTTCGCTCAGCACTCGCACCGCCTACAGAATGACAGGGTTCTCGCCGACCTCGGCGGCAAAGTCGTGCTTGTCGTCGA
GGAAGATCTTGAGCTTCTGGTCCTGCAGCTTGCGCATGCGGTTCTTGGGGAGCATGCCGTACACAGCCTTGCGCAGCACGTCCTCCGGCTTGCGCTCGAA
CAGCTCCTTGGCCGTGCGCTGCTTGAGCCCGCCAGGGTAGCCAGTGTGCCAGCGGTACAGCTTGCCCTCCCACTTGTTGCCCGTCAGCACGATGTCCTTG
GCGTTGATGACCACGACGTAGTCGCCGCAGTCGACGTTCGGCGCGTACGTCGGCTTGTGCTTGCCGCGCAGGATGGGCGCGAGCTGCGACGCCAGGCGGC
CGAGCACCTGGCCCTTGGCGTCCACCACGTGCCACGCCACCTTGGTCGCGTGCGCGATCTTGCTGCTCATGCTGCTCCGCGTCCCGAAGGTCAGGCGCTC
TTACGGTTGCTTGCCGCCTTGCGCTCGCCGCCACAGGTCTCCGGAGTGACTGGAATGGCCGACACCGAGGCAATATACCGGTATCTAGGTATCACCGGTA
TTTTCAAAACCGGTACGAGCATGCTGCTAAGTGGATATGCACCAGGTTTTCATTTGGCAAATGGCTTGCCTGTGCATGTCAAGGTTTTGGACAGGTTGCT
CACACTCTTTGAAACCGCCGGCTGCGAAACCCACAATAGCTGGGACTGCAGCATTTGCGAGCGAGCTCAAGAGAAATGGCGCTCAAAATCGCGAGAGACA
AAGTCAAATCCCTTGCCAAAAAATCCGTTCGAGTCTCAAAAATCAGAGCCAAAAGCAACCCAAAAGCGAAAAATCAGTCGACATATTCAGGCCGCCAACT
CCGCTAGGTCTAGGGGTGGCTATACCTATCTTTCTGATCATTTGGCTTTTACGCGCCGCATATTCAGCGAATCACCGCGCACCGAACTGGTCACCCTCGC
CTGCTACTGGACAAAACCCCCAAAACACATATCGCACGCTAATCTGGATTTTGCGCTGAGAGCGCCGCGCTCCAATTTCGTGGGCGGAAGGAGGAGGCAG
GAAACCACTAACAGCACAACGCCGGTCGCGGCATACATTTTCCCATAGAACGCCGGGGTCGAAGTCGTCGCCGCCGTTCGAAGTGAACAGCGAGGGATCA
GTCGGGAGCGGCCGCGATCAGTTGGGAAGCGCACGACCTAGCGACAAGCTGACGGCACCGTTCACTGTTCGGAAAACCAGCAGCGCGAGGACCAGCTCGA
GTATGGCAGGGGGACGCTTTGCGCTGCGGGCGTTGACCGCGGTCGCCGCGCTCATCGGCAGCGCACTGACAATGCCGCACGTGGCCGAGGCTGCGGCCGT
GGACGGCGTGATCATGGTGCGCGGCAACAAGATGTACAACGCCAAGACGAGCGAGCGCTTCTTCATCAAGGGGGTAAGTGGATCGCGGCCAGTACTGATC
TGGAGCGGACTTGTGTGGGGATGCTGACGATGGCGGTGCGGCTCTGCAGCTGACGTACGAGTACGCGGTGAGCGACGACTACTACGACAAGAACACGAAG
GACGTGATCGCGACGACGCTCTCGGGCCTCGATTACAACACGCTGCGCCTGTACAACGTGAACCCGGACTACTCGTACAAGAGCTTTATGACAGACATGG
CCAAGCTCGGCGTGTACGTGCTTGTGCCGGCGTCGCCCGACAACGACGAGTACTTTGGCAAGTATCGCTACTCGACGATCACCAAGAAGCTCTCGTGCAA
CGGCGACAGCTCGGGCAGCTCGTCGTCGGCAGGCTCGACGTGCTACCCGGCGCTGCTGCTCGAGTACGGCAAGAACGTACGTACTGCTGTGGTTGATGGC
TGCTCGCTAGTGTCCAGAAAAGTGTTATGCTCATGTTGTCGTGCCTGATTGATGTACAGATCGCCAAGAACTTTGCTCAGTATGACAACACGCTGGGCAT
CGTGGTGGCCAACGAAATCATGCAGGTGGACCTCACGGCGGCCTCGTGCGTGAAGCAGTATGTGACGGACCTGAAGAACTGGATGACGGTGAACGGCAAG
AAGATGCGCATCCTGCCGCTTGCGTATGCCGCCGCCGATAGTAGCTACGGCACAGAGATCACGAACGCCGACGACTACCACGTGCTCAAGGTTCAGGGGT
TGCTCTGCGGCGACACGATGAAGAACGGCATGATGCAGAAGAGCATTGACATCTATCTCATCAACGAGTACCGGTGGTGTCCCGGCTCGACGTTCGCGGA
AGCCTACCAGCGGTACATCACGATGGCGCAGGGCATTCCGATTGTTGTGGCATTCGGCGAGTACGGGTGTAAGACGGACTCGTCCACGACCCGCGACTGG
AAGATGGTGCCGTATCTGTTCCAGGAGCCGTCTGAGACGAGCGAATTCAGCGAAGTGTGGTCGGGTGGTGTCGCGTACTCGTACGGTGAAGCCAAGCTCG
GCACGGACTCGCTGTTCCCCATGTTTACCGGTGCGTGCTGTAGCTCACTATTGTTGTCCCGATTTGCTCGACGACTGACAGTTGTGACTGCCGTGTTGCT
TGTAGGTGGATCAACCGACATGCTCTCGACGGTGAGCTCCAAGTCGACCACCGACTACACGAATCTGAAGGCCATGTACGCCAAATACTCTGGTTACTCG
GACCCGGCGGAGTGGACGTCGAGCACCAAGTGCACGTGGGCTCCGGACCTCGCGACCACGACGCAGTCTGACAACTCCCGCGCCACGGCGGACGGCTGGA
TCGTGAAGAGCTGCACGGCGTCGGACCTGAAGGTGATCTCCACTGACTCTTGGGTCTGCTCGAGCCGCGAGGGTGCCATCTGCTCCGACGATGGCGACAC
GTGCGACGTGACCATCTCGACTGCGCTGACTACGACGCAGGAGGACCTGTGCGGTTCGTACGAGGTCGAGTCGGGCGGCGGCACGTGCGAGAGCTCGAGC
GATTGCAGCGGCAACGGCCAGTGCGTCTCGTCGAACGGCACCATGTCGTGCAACTGCAAGACGTGCTACACTGGTACGGACTGCAGCGTGAAGGACATTT
CGACGTGCAGCTCGCTGTCGAGCTCGTCGTCGGCTCCGACGGCCATCTTCGCTGGTGTCGGCGTCTTCCTCGCGGTGATGGCTGTGGTGTTCGTGGGTCT
GGGTATCGCTGCCTTCAACAAGAAGAAAGGTACGGTGTTGATGGCTTGCTGTGATGAGTGGGAGTAAATCTAACAGTTTGTGATGCTGTGCAGCTCAGGA
CCAGCTTGGCGACCAGGTGAAGCTGCGCAGTGGCGGCGGTGCTGCAACGGGCAACACGCAGGCGGCGACGCTGTAGAGCGGCACGTTTCTCTTCTGCCTG
CCTGTGCGGCGGTTCACACGTCGCATTTTATACCTACCTTAACCCGTTTTAAACACTATTTGGTGTCGATTTCGTGGTGCGTTTTATGCATATCATCACA
GATTTAAACACATCAAACTCCTTCGGTCCGGAAAGATTGGTGTGGGTTGATTGGCCACGCTGTCGATCATTCGTTTTTCACACGCGATATCCAAACCCGA
AGCCCGCCATGCCGCCCAAGAAGAAGACCGAAGAGGTGCGGCGGGAGCGAAGCAGAACGGCTTCCAAGCGGCCTGAGCGCTCGTAGCCTCTCGCTAGGCG
CTTCAGGCTGCGAGGGAACTGTCTGGTTGTAGTTGTATGGTCCGGAATACTCACCGAGATTGGTCGCTCGTTCGGTTCATTTTTTGCAGGTGCCGCGCGT
GTACCTGGGCCGCCCTGGCAACAATGTCAAGATCGGTATCGTTGGCGTGCCGAACGTGGGCAAGAGTACTTTCTTCAACTGCCTCTCCAAGCTGAACATC
CCCGCCGAGAACTTCCCGTTCTGCACCATCGAGCCGAATGAGGCTGTTGTGCCCGTGCCCGACCAGCGCTTCAACTGGCTCGTGGAAAAGTACCAACCCG
CCAGCGTGTACGTACAGGGGGATCGTCGTGGTGTCTTCGATAACAGTGCTCGTGCGTATCTGACTGTGGTCTTATATATGTGAAATAGTGTGCCGCCGGT
CATGACCATCACGGACATTGCCGGTCTCGTGCGCGGCGCGTCTGAGGGTGCCGGTCTCGGTAACGCCTTCTTGTCGCACATCCAGGCCGTGGACGCCATC
TACCACATGGTTCGCGGTTTCGACTCGAGCGAGGTGACCCACGTGGAGGGCAGCGTCGACCCTGTGCGCGACATCAAGATCATCCAGGAGGAGCTCCGTC
TCAAGGACCTGGACCGCGTCATCAAGCAGGCCGAGGGCATGAAGAAGAACGTGGAGCGCAACTTGGGCGGCAAGGAGAAGAAGCTCGAGTACGAGGCGCT
GCTGAAGGTGCAGCAGTGGCTCGAGGAGGGCAAGGACGTGGCGAGCGGCGACTGGGCGGCGTTCGAGGTCGAGGTGCTCAACACGATGCAGCTGCTGACG
GCCAAGCCGGTCGTGTACCTGGTGAACGTGAGCAAGCGCGACTACCTTCGCAAGGGCAACAAGTACCTGCCGAAGATCGCCGAGTTCGTCAAGGAGCGCG
GCGGCAACGAGCCGATCATCCCGATCAGCTGCGAGTTTGAGCTCGAGATGCTCGACCTCGAGGCGGGCGGCCAGCTTGCCGAGTACCAGAAGGAGAACCC
GACTCACAAGACGATCCTCAACCGCGTTCTTAAGATGGGGTACCACGCGCTCGGTCTGGTCCACTTCTTCACGGCCGGCAAGGACGAGGTGCGCGGCTGG
ACGATCCGCAAGGGTCGACTGGCACCGCAGGCTGCCGGCGTCATCCACACGGACTTTGAGAAGGGCTTCATCATGGCGGAAGTGCAGGCTTTCGCGGACC
TGAAGGAGTGTACGTGGACTGCATCGTCTGTGCAGGATGTCGCGATGTGTTGTACTAATGAGGTGTGTATGTGTGATGTGCATCAGTGGGTTCGGAGGAG
GCCGTCAAGAAGGCGGGCAAGCTGAAGCAGCAGGGCAAGAAATACGAGGTTCGTCATCGATCGCAGGAGCTGTGCATCGAAGAATTGCGGCCAGCGCGAC
TGACGCTATGCTTTCGTGCCTTCCACACAGGTCATGGATGGCGACATCATGTTCTTCAAGTTCAACAACTAGATGATCCGTACGAGTTGGGCTTCATTGA
CGAGCTTGAGACCGATCATCGATTGCAGCGCCAGCGCCTCGGGCGGTTGGTGGGAGTTGAGAAGCGATTGCGTGCATGGTCTCTGCTGTCTGTGCGAGTC
TTGACGCGTAGTCTAGACTGTTGTTTCCTTGGTTGCAGATGGAGAGCATTGGAGACACTGGGTGATCCAATCGAGGCAGGAAGCAGATAACCGTCGATTG
CAGAAACATGGCACCAGGCTCTTCCCTCGCATTGTTGAGTTGTTGTTGTTGCTGTTGTTGTTGATCCTCGGTGTCGGTCGGTGAAGCAGAGTTGCTGCCA
ATTGAGACCATCCTATCTCACGGTGCGTCCCAACAAGAGTGTGGCAGTTCGTATTTCCGGAATTCGTTGCAGGGGACTTGGATACACCAGAGCAGTCGCG
ACTCTTTGCTGCCTGCTCGCTCGCTCATAGCAACCCTTCGCCGGTGCAACCGCAGGCTATTCATCGCGGCCGTGGCAACGACGGAGCATCAGCACCACAA
TACCGAGCGTGGTTGAGGTAGGAGAGCATCACGCTGAGTCCAGTCGAGTTGGCATCGGCAAACGCCAAGTGTGAGCTACTTCTGCCGTGCCTGACTGGGT
CGTGAGTGCGTCGCGGCATCATGGTGCGTTTTGCCGCAGAAGCTGCTGGATGCGCTTCAGTGGGTTGAGAATCTGACCGAGTGCTTCGTAGCCGATCGGG
TACGGATGTGAGCCGGAAATGGTGTGGGCGGCGCCGAAGCAGGCGGGCGACGTTCCGATCAAGCGCTCGGGTCACTCCTTCACGCTCAAGAGTTCCGAGG
CAGAGACGTGCGTCTACCTGTTTGGCGGTTGCGACCACAAAGCGCCGCCCGGACCGACGAACGACCTGTACAAGCTCGACGTTGCCAGCGGTACGGTGTT
CTTCAGCTCGTTGATTGGTTTCTGATGATGCTCACTGGATGAGCGTTGTGTGTAGGCTCGTACACATGGTCTAAGGTCGTCCCGTCAAGCATGGAAGCCG
AAGAATTGCCCCCTCCGAGGTGGCGTCACTCGGCAGTGCTGTTCGGCAAGCACCTGGTCGTATTTGGGGGCTTCGCGGCCGAGAAGCGCATGAACGATGT
GTGGCTCTTCCACACGGAACTGAAGGTGTGGGAGCAGAAGCACGCGGGCGGCGGCATCTGGGAGGGTCTGCCCCAGTGTCGCGGCGCGCACACAGCAACG
CTCGTGGGCGAGAAGATGGTCGTGTTTGGCGGCTACGGAGGCAACGGCTTCGGCCGCACAGACTTCAACGACCTGCATGCACTCGACCTTCAATCATACC
GATGGGAAGAGATCCCTGCTGATGGCGGCGGCGAGAAGCCCGAGCCGCGCTCTGGTCACCAAGCCTGTCTCGTGGGCGATGACCAACCCAAATTGCTCGT
GCTCGGCGGCTGGAACAGCCTGCGTCAGTTCCAGGACATGTTCGCATTCGAGTTTGCCACCAAGTCTTGGAGCCAACTGGAGGTGCACCTGCCAGCCCCG
ACGTGGAATCACGCGTGTGTAGCCGTTGGTGCCGTGCCGCACTGGAAGGTGTTCATGTTTGGTGGGAACTGCGGCGATTTAGCTGAGGGAGGCAGCGGCG
GTGTACAGGGAGCCTTCCTGAATAGCGCGTCAGTCCTGGACACGGGCAAGATGGTGTGGCTGAGTCCGCCAGTCAAGGGCGACATACCCGCAGCACGCGC
CGACACTGCTCTCGTCTTTGATCGCACAACGAATCACTTGCTGCTCTTTGGCGGGTGGGCGAACCGCTGGTTCAATGATCTGCGGGTGCTCAACGTGAGC
GAGATCGTTGGACCGCCGTACGCGATAGCGAGTGTCGAACCAGCGAGTGGCCCCATCACAGGCAGCGCCAAGCTCAAGATTAAAGGCTACAACTTTATTG
GGGCGTCCGGCGCAACGGCCACGACTGCGAGCGTGCGGTTCGCGGTCGCCAAGGGGTCTGTGGATGTGCAAGGTGCGGTTATGAGTCCGTCGATGCTTCA
AGTGACAGCTCCAAGCTTCGAGAAGTTTGGACCGCTGCTCGCTGAAGTGCGCATATCGCTACCTGGAGGTATGCTGACGAACGTGGCGGCGACCTTTAAG
TTCCACTCGGTCACGGCTGCGCCGAAGACGCTTGCGTTCGGGCCGTGCCTCATCCACGCTGTGAGTGAGGGTTGCCTCGCTCAAGTTCCAACCACTTTCA
TCCTTCAGGCGCGAGACAAGGACGATGTGCCGCGCGACTGCGGCGGGGACGAGTTCGTCGTGACCGTGACGAGGACGGAGAGCACAGGTGAAGTCGGTGA
ATCGACTGAAGACACGCCAGAATCACCACCACAAGCAACGCCGACTATCACTGACCGAAATGACGGCACATATGTGGTGACTCTCGTCGTACCAGCACCA
GGAGCATATCAGATCGCGGTCGACTTCCAGGGTACATTCGGTGGGATGGCGGGACCCGTTCGCGGCTCGCCTTTCGTGGCGCAGTTTAGTCCGCTTACAG
ACGAATCGCGTGCCAAATGTCTGCCGCCAAGTGCAACACCCAAGGACCTCGAGTCGCCTGATCTGCTACGGCGAGTGATGGCGGCCATGAACAAACGCAA
CGGAGACTTCCGTCGGCTGCTGGTGGATCTACGCAAGGATATTCCGAGCAACGAGGCCGACGGGTTGGATACTCTGCGAAAGGTGAAGGAGATTGTCAAG
AAGCTCGAGACGGAACGCGAATCCAACCACCTCGTGCTGGACCAAGTGCGCCAGTTCTTTGCGCAGATCAAGAATTCTGGCGGACAAGTGGACAAGGAGC
TCACCGAGCTCGACGGCATGGAGAAACTGTTTGCGGATGTCGAGCGCCAGGTGCCCGTAACAGAACAACGTATCCAGGAACCCACGCGCATGTTTGGCGA
GAAGACGGAGGAGAAGATGGTCGCGTACGAGAAGACTATCGCCAAGCGGATGGAGACGATGAAAACCCTCGACTTTTGGTCCTCGAGCCTCGAACCAGAC
AAAGGACAGGAGAAGATCGCGGCATACCTTGTGGACTGGGAGGCCGAGATGCGGCGGTGCGAGGAGAACACGAAGCTGTGCGGCGTGTTTGGGTTCCCTC
AAGTCATGAACGAGTCGCGACGCATGATGAGTCTCATGCGTGCGGACGCCGAGGGGATGAAGGCTGTCTGGGCTATCATCAAGCGCGCCAAGAGCTTCTT
CCAGGCCACGAGCGAGGTGCTGTTCAAGCAGGTGGACGTGAACACGCTGCAAATTGAGATCCAGTCGATGCTCAAGGAGCTCAAGAAGATTCCGAAGGAG
ATCCAGTGGTGCGACGCGTACACGTCGATCCTGAAGGAGTGCCAGGCGTTCGACAAGACCCACCCGCTGCTGCGCTGCGTGGCTGCGAGCTACATGCGAC
CGCGTCACTGGAAGCGGATCATGGCGAAGACGGGCGAGTTCCCGACCCCCGACGAGGATCCCGAGCAGCGCCTCGGGCTCATTATGAGCAAGAACCTTCA
CAGCTTCAGCTCGGACATCACCGAGATCTGCTACGAGGCCGAGAAGGAGCAGGAACTCGAGCTGCGTCTGGTGGAACTCGAAGGCATTTGGGCTGAGGTG
AACTGGGAGATGACGCCTTACAACCCGTCCGCAAGCGAAGCCGACCTCGTCCCGCTGCTCAAGGTGTCTGAGGAAAACTTTGAGCTGCTCGAGACCCACC
AAATCGATGTGCAGGGTATGGCGGCCTCCCCTTACCAGTCCGAGTTCGAGCCGCGCGTCGCCAGCTTGCAACTCGGACTCGCGTCCATCAACGAAGTTGT
CGTGCTGCTAGGCGACATTCAGCGTTCGTGGAGCTACTTGGAGCCGCTGTTTATCCAGTCGGAGGAGGTCAAGAAGCAGCTTCCCGAGCTCACAGCCGAC
TTTGAAGACATTGACGTCGATGTGCGGAAGATCCTGCGCGTCGCGTGGGCGGAGCTGAATGTGCGTAGAGCGTGCACGGAGCCAGGGCTTATCAAGCGTC
TTGAAGCCATTGTCGAAAAACTCGAGCTGTGCAAACACCGACTCAAGGAGTTTCTGGACGGTCGCCGCCGACAGTTCCCTCGCTTCTACTTCATGTCGGA
GGCCGATCTACTCGACATCCTCTCGAACGGTTCCCACCCGGACCGCATCATGCCGCACTGCTCCAAGATATACCTCGCAACGAAGACACTAACCCTCGTA
GACAGCGGCGAAGGCGGACGTCCCATGGCGACCTCGTTCATTGCC