Description :
From Genome Similarity Track
Location :
Scaffold_1660:38- 1140
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1660-fgenesh-gene-0.0Metalloprotease family M20D

Sequence
1102 bases(100 bases per row)
GCCAGATGCCCCAATGGGCGATGATGCTGCCACTGAGGGACACACGGCACCTGGTCAACAGGCTGGTGAAGAAGCAAGCGGCGACGTCGACATGGAGTCG
TCACCAACGCCGCCAGATGCAGCAGACGGTGACGACTTTGACCACGACGTGAACGGAGGTGGCCCAGCAGCTGCGCACGCGTGCGGTCACGACGGCCATA
TGGTCATGGTGCTGGGGCTCTGTGCGCTGATCGTGCGCAACGCCCACTTGCTCCCACAGGACACATTCGTCCGGTTCATCTTCCAGCCAGCGGAAGAGGG
ACCAGGTGGCGCTCAGAAGATGATTGAGGAAGGCGCGCTCGAGGGTGTCGACGAGGTCTACGGCCTGCACAACTATCCATTCCCGCTCTACAGCGTGCAC
ATGCGTCCAGGCCCGGTGATGGCCCACGAGGTCGAGTTTTCGATCGATATCCAGGGCGTTGGCGGCCACGGCTCGGCTCCTCAGCAGTGCGTGGACCCGA
TTCTGGCCGGCTCGATGGTCGTTCAAGCGCTGCAGACGGTCGTGAGCCGCTCGCTCTCCCCCACCGACACGGCCGTGCTCTCCGTGACGCAATTCCGCGG
CGGCGATACGAACAATGTGATCCCGGCGAGTGTGTTCTTGGGCGGCACGATCCGCGACTTTGACCTGGAGGTGGCCGAGAAGATCAAGGAGCGCATGGAG
ACCATCGTGCGCTCGACGTGTGCGGCCGTGGGCGCGACGGCACAGGTACACTTCTCGGACGGCTACGCGCCCGTGATCAACCCGTACGAGGAGACGCGCA
ACGTACAGCAAGTGGCCATGGACATTGGCCTGTACGTGAGCGAACAGGGGCTGCCGCTCATGGCGGCCGAGGACTTTTCGTACTACCTGCAGGAGCGCAA
AGGCTGCTTCTTCTTCCTGGGCACCAAGGAAGACGGGGACGATGACAAGATGCGCGCGCTGCACTCGAACGAGTTTGACTTCAACGACAAGGCCACGCCG
CTGGGCATCCGCCTGTTCCTGGGCATCCTCCAGTCGCGCTTCCAGTGCGAACTCTACTCGGTCGAGGAGCTCCAGGCCTTCCAGGTCGCCATGGAGCGCA
TC