Description :
From Genome Similarity Track
Location :
Scaffold_843:38- 1039
Sequence
1001 bases(100 bases per row)
CTGGAAGTCTGTGAGTATGGATTTCATATTCGGACTTCCAAGGGACAAACACGGCAGGAATGGCATCCTGGTGTTTGTGGACCGATTTAGTAAGATGGTG
CATCTTACTCCGGTGTCAGACAAGATCTCGGCAGAGATGACTGCAAAAGTCTTTGTAGACGTGGTGTTCCGTCTACATGGTCTGCCTTCGGAGATCGTGT
CCGACCGAGACACTCGGTTTACGTCCAGATTCTGGCGTACTCTGTTTGGCATTTTGGATACAAAACTATCCATGTCAACAGCAGCACACCCAGAGACAGA
CGGTCAAACTGAACGAGTGAATCGTGTCCTGGAAGATGTATTGCGCAGCTATGCGACGTCTTTCGGAGAGTGGAGTGAGTTTCTCCCTCTCGCTGAGTTT
GCGTTGAACAACTCTACGCATGTCCCGACAGGTCATACTCCGTTCTATGTGAACTACGGACTCCATCCGAGAGTGCCAGCGTCACTAGTACGCGGAATCT
CTACCTTAAATGGGGGAGGGACTATGGCTAAGGAGCCACAGTCGGACCTGAATGCTGTTGCCGAGTTGAAAGCCAATTTCGACTCGATGAAACCTCTAAA
CGACATGACAAGTCGTGAGGCACAGCAAGTCGATGACTTTATTGTGAGAAGACAAGCCATTGTAAGGTTTGTTCGAGACGCAATTGCAAAAGCTCAGGAT
CTGCAAAAGGAACAAGCAGATAAGAGTGGAAGGAAGAACAAGCAAGTATATAAGATCAATGATCTTGTATTACTTAGCACGGCTAATCTGCCTGAACATG
CAGTGTCTAACTTGGGAAACTCGAAACTTCTACCAAGATTCATTGGACCGTTCAGGGTAGTTAAATGCAATGGGGATGCATACACACTAGACATTCCTAA
ACGCATGCGACTACACCCTACGTTCTACGTAGACGATTAAAGCCTTATCTTCCAAGTGGGTCAGCAAACCCTATAGAACCTTTGACGGGCGATCAAGTTG
A