Description :
From Genome Similarity Track
Location :
contig_49:379767- 382546
Transcript NameFunction/comments
g8319.t1conserved hypothetical protein
g8320.t1hypothetical protein

Sequence
2779 bases(100 bases per row)
ACTTCGTTGCTTTGACCAGTACAGACCCCGACCTATGAACGTGTTCGGTTTCAATTGCATCGACCACGCAGCATTGACGAGTGAGTCGTCAATGACGACT
GACTGACCTGCATCCGCGGTGCAAATCGCGAGGGAGCGCATCATGTTGCGTGAGTCACGAGGTTGAAGTTCCCTTTGACGAACAATGCGCTTATATTTGA
GAACTGCATGAGAGTCCTGCACGCGCAACAGAACAAAAGGCGTCTTACCAATCGAGGTCCAGCTCGTCGGGGCCTCGTCGTCGGAAGGAGACACGCGCGG
ACGGAACGGGTCCGGCGGGCGCTTGAAGCTGAAGGTGCGGCTGAGGAAGCTGTTGCTGCTTCGACTGCTGCTGCTCAGACTGTCGGTTCCACTGGTGGAG
CACTCGCTCGAGTCGTAGCTCGACCCAAACGGATTGGACCGCGGCCCGAGGTGTGCCTTGCCCGTGACGTTCTTGACGCACATGGCGCAGAATAGCCGCT
TCTTACTTCGCCCAGACTTGCTGAGCAGGAAGATGTGGTGCTGCTCGGAGCAGTCCCGACACACCGTCTGCACAAGGTGTCGTCAGCGGATGTGGCCATT
GCAAGACATAGAGCGCGTGGACGTACCTGATGACAGCCCGAGCACTGCGGGTAAGAGCCCAGCTTGGGTTTGCACGTGCAGACGTGGCAGATAGTGCTGC
TTAGGCAAGACAGGCAGGAGCACAAGTTAGCTTTGCAGTGAGACAGCGAGCGGGGACACGCAAGTACCTGGAGGGCAGCCACTGGTGGCTGTCGGCTTCG
TCCATGAGAGCGCTGAATTTCTTGGCGCGGCCGCCTCGCGGGCTGTTAACGACGTTGAGCCAGGTGCTGGCCACGCCCAGCTGAATGGCCTTCTCGGGCG
CGGAGCCGAACTTGAGGATCGACCCCCAGAGGAAGATCTCCGTCTTGTTGGTGCGCTTGTGGCGGCGGTACAGGTAGCACGACGCGGTGTGCTGGCGCAG
CATCCCGGGCGTGGCTTCGGACGGCCACTCGGGTCTTTTGATGGACTGCAGCGTGTGGTACGTGAGCTCGTGGCCGCGCGCGTCGGTCGTGGTCCCCATC
CGCTCGTAGGTGAGTGCGTCTCGGTCGTGGAGCAGCCCCCACGCACATCGCCCAGCAAACCACTTGATGCCTGCGAACCGGAAAGGGTCGTCGGGTGTCC
GACGTTCGTGGACGTTGAGCACAGAGCCGTCCTTGAGGTCGTAGCCTAGCAGCACCTTGGCCGTGCGCAGCTCGTCGGTCGTCTCGCAGTAAAGTCCGCT
CATGACGTCTTCGATCCGGCCGTCGATGAGGCCTGTGCCGACCATGACGATGATCGACTGGTTGGTCGAGCCGGGCACGCTGTTGAAGACGCTCACCTCT
TTGCGGCGCTTCACGAACGCCCAGTGCTGCGGGTCGACGTTCTTGGGGTTGAACTTGGCCCGCTCGGCCACCGTGTCTTGCAAAAACTTTCTCGCCGCGT
GGTCGTACAGCGCGCGGTCCTCGGGCGTCAGTTTGATCTGTGGACAGCGATCGGGGCCGAACATGGCGAGTGGCTCGCAAAATGCGTTGTGAGCATTCCA
AACAGACGTGGGATAGCTGCGAACGCCGTATCTTAGTCTGGATTGTCTATCTGCGCCTGAGCGACTCGGGATCAACTACGACTGCCTCATCTGTGTCAGC
TCATGGAGGAGCGGTACATGCACTCGACGGAGCCAACATGACATCCATCAACGTCGCTTGTCAAATGGACAGCTGGCCTCACGCCACAGCACATGCAGTG
CTGTGCAGGGCCATGCAGTTCGCCTATTTTGACGAATGTTCGTACATCGAAACTGCTATGGGGACCAAGAAGCGCCAAAGTAAAGGAACACGAACACAAA
AATTGGGAAACTGGAAGTTGTTTCAATTAGTTGGCGAGGCAACATGACAATGGACCGACGTGGTCTCGGCCCGGCAAACACTGTCCACATGTTCAACCTT
CGCTCATGCACCAAAGCCAGGCAAACGCATTCGAGTCCAATGGCGTCATCCGACTACGCTGGGCAGACATTCCTTGTGCTTTCTGGACCTGCGCACCTGC
GCTTACAGCTTGGGGCCAAGCCGATCCAGCACTGACCTCTTCTTGGCTGGGGTCTCGCCCGAAGCCTTGCCACGGTCGTCGCTTTTCTTGCGTGGGGGCC
TCTTGCGGTCATTGCCACCTCCTTTGCCATCGGCCTCCGCCTCGATCCGCCGCTTGTCGTCATCACCGCCGCGACGGCGGTTGCGGCCTCCTCGCGAGCC
GCGAGACGAACCCGATGTCGCTGTCACTACACGACCGCCACCACCGGAACCTTTTTCGCCGCGACGCTCGCGCTCCTTCTCCACACTTCGACGTCGTTTC
CGATCACCTCCAGTGGCGGCGCCCTCGTCCGCAGCATCGCGACCGCGCTTTCCATTGCGGTCATCGTCGCAGCGTCACGACTTCGCTTTCCATCGCGCTC
CTTGCGGCCATCGTGCAGCATCGCGACCTCGCTTTTCATCGCGCTCTTTGCGGCCATCGTCCGCAGCATCGCGCCCGCGCTTTCCGTCCGCGGCATCGCG
ACTGCGCTTTCCATCACGCTCTTTGCGGTCGCGAGGACGATCGCGTTCGCGCTCATTCTTGTCGCGATCGCGAGGTCGGTCCTTCTCACGGGGACGCTCA
CGGTCGCGATCACGTCCACGGTCCCGATCGCGGTCGCTGCGTTCTCGGTCGCGTTCACGATCGCGGTCCCCACCGCTGC