Description :
From Genome Similarity Track
Location :
Scaffold_27:3797- 11322
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_07290Hypothetical protein
Sappa_CBS223.65SPRG_07291predicted protein
Sappa_CBS223.65SPRG_07292Heat shock protein 40 like protein
Sappa_CBS223.65SPRG_20359Hypothetical protein

Sequence
7525 bases(100 bases per row)
GACTCGGTGGTCGAGAGTTCTGTCCTTGAGTCGTCCATGCTGGAGTCCTCGGTGCTTGAGGCGTCCGTCGTCGACACGTCCTTCGTCGAAGAGTCGGTCG
AGTCTTTTGCTGCAACAGATCCCGCTGTCTTGCGCGGCAGGGACATGGATGACGACGCGTATGCGCGGCCAAAGACTGCACCACGCATGAGTCTCCGCGA
CAGCTTGCTTCACACCCAACAGTCGGCACCTCTTCGGTCGACGACGTTTTCTCGCCCGAGCATAAACCGTTGGGACAGTGATGAGGATGACGTCAATCTA
CCAGATGCAACGCCCCTGCAGAGGTAACTCATCGACTTCAGCGCGTGTTCTCACAGCGTCGTGCCTGTAGCCTGCGCCACAATGACACGATGGGTACGTC
CTCCAGTTGCAGCGTTTACCCAAGCGATTTCGCTGTCTTTGTGCGTAGACGACGATCTGGAAGAGGAAGAGCTTGCGTAATCCATCGACACAATTTTAGA
CATCCAAAAATGATGCATCGTCGCGCGGCGGCAGCACGTGTACCAAGAGGAGCTTGAGCGCGATACCAAGACCTTCGTTGGTCTTGGCGCTCACTGGAAA
GCAGTCGAGTCGCACCTGCTCGTGCCACATTTGGTCGCCCGCGTCCAAAGGCTGTTTGATAGGGCAGTCCGCTTTGGACTGGAACACCACCGCCGGAAGC
CCGAAGTGGTGATCAGGGCTAGGGTACATTGTTTGCAGCACGTCGTAGTAGGCCTGCACGTGCTTGCAGCTCGAGGCGTCGGTCGTGCTCGCGACAAAGA
TGACAGCGTCGGCGCCTTCGAGGTACGCTCTGTCCTTTGAGAGATGCGGCGTCGACGGCACATCCCACATCTGCGGCGTTTATGGCATCAGTCAACCAAT
CGACTTGGCACATACTTCAATCACAATCGTCGGTCCACCGTCGAGTGCGATCGACTTGAGTCCAATGTTGACTACATAGTATCCCGGAGCTCAATCCTCA
AGGGTGTCGTGAAGCGACGGACTGTACCTCCAACGTCGACTCGGGACGCGCTAGGCTCAAAGTGATTGCGCAAGAGCCGATAAAAGATGCTGGTTTTGCC
GACTCGTGGGCCGCCAAGAAGGAGCACCTTGATCTTCTTGAGTGTCACCACGTCTTCCGAGACCTTGCACCCCCGCACTACGTTCAAGTGCTTGGAATCA
ACCCTCGGTCGGTGTATGTGCACGGCACCGGTGGATGCAATTGGACCCATCGTCCGTTTCAGCAACTTCAAAACGTAACATCAAGCGGCTTCCACCATGC
AGCGTCGCGTGTTTCGTTTGATTGAAAGCTGGCACTTGTTGGACGCCTGCGAGCGTACTTGCACTCGACGCTAGTAGCTGTGCCGACACTACCATGTGCC
GACGTCGTTGTCGATACACTACCATTAGTGCATGTACACTATTTCACAGGTGTCAGGAATTACAGTGACGTGCAAAGTGGCAGAAATTCGAAAAGATCGC
CCATGCACGCAAGAGCGCGGCTGGCGGCGGCCTACAGCTTCCCGTGGACGGTCTACGGCGTGAGCTGGAGCAACAGCCGCAGCGACAAGGTGCTCGCCGT
CAGCAGCATCACGGAGGAGTACGCCAACCACCTCCAGATCCTCGAGCTCCACGAGGCTGACATGGCCGAGACAAGCAAGAGGTACACGCTCACCGTCAAG
GCTGGCGTCGAGCATCCGTACCCGCCGACGCGGGTCATGTGGTCACCGGCGACGATGCCCGAGACGCGGCTAGCGTCGACGGCCGACTACCTTCGCATTT
GGCACCCGCAAGAGAACGGCCTGAGCTTGAGCGCGATCTTGAGCAACAACCGGACGGGCGATTCGTGCGCGCCGCTCACGTCGTGCGACTGGAGCGACAT
GGACCCGAACATCCTCGGCACGTCCTCGATCGACACGACGTGCACGATCTGGGACCTCAACGTACGCCGACCTCGCCGCCTCCGCACTCCTCATAAAGTG
CAGATTTCTAGAACACCAAGCAGGCCAAGAAGCAGATCATTGCCCACGACGCCGAGGTCTTCGACATGGCCTTTTCACCGCTGCATGGTGGCAGCAATAT
CTTTGGGTCCGTCGGCGCTGACGGCTCGCTGCGTGTGTTTGACATTCGGTACGACCTCCTCTTGTGCTTCGAACCGTTGACGCACCGCGTTGTAGCTGCT
TGGAGTCGTGCACGATTGCGTACGAGACGCCGGACCTGAGCGCGCTCTTGCGGCTCGCATGGAACAAACACGACGCCAACTTTGTCGCGGTGATGCTCGT
CGACAGCCCGACGGTCCTCGTACTCGATCTGCGCATGTCGGCGTCGCCGTATGCGCAGCTCACCAACACCAAGGCAGCGCACAACAACAGCAATGTGAGC
ACCGGTCGGCCTCCGAGCGTCAACGCCATGGCCTGGTCACCGACGTCCGCGCATCACATTTGCACGGCTGGAGAAGACCACGAGGCCATCATGTGGGACA
CGCGTGTGCACGCGCCCGTCTTGCAGTATTCCGGCGGGTCGTACATCAACGCGATTGGCTGGTGCCAGACGGCCCCCGAGTTTCTGGCTATGAGCATCGA
CAAGACGCTCCACGTTGTCACCATTTAACGCTGTCCGAAACAATCTGGTTTGAAATGACCAGTCTTGCCCCAAAATGTCGTCAACCAAAAACCAGTTCCC
ACATGTCGTCTGCGTCGAGATGCGAGACGCAAGTTGGCACTTCATGGCCGCCCACGTGCGCAGGTGCGACTCGCTCCCGTACGCCTCCGAAATCAGTGCG
GTGTGGATCGCCACGCAGACGCGTCGCAAAGAGGTGTAGCAACGATGTGAGCGTGTTGAGCTGGCATGATTTACTTCCACTTTTTCTTGTACTCGTCGTT
CTCGACGACACCAAACTTTTTGCCATCCTTGCGCTTCTCGGGCGCCCAGCCAGCACCGACGTTGAGCGTCTTGGCCTTCTTGCCATCGACTTGGAACTCG
GTCCAATTGCCCATGCGCTTCTCGCGCCGGTCGTTCTGGGACCAGTCCTTGTCGTGCTGGTACACGGCGCGTTCCTACGATCGTCGATCAGCGTCTTTAC
AGTGGCGAGAATACAACCTTTTCTTTGGCTTCGTCCTCTTGATCGGCTTCGCGGCGGCGCTGCGCAGCCTCGCGCGCCTCAAAATTGCGTCGGCGATTCT
CAATTTCAGCAAACGCCTTCATGACCGCCTTCTCCTTGACCTCTTCGATGGGCGGGAGGTCTTTGGCCTTGAACTTTTTGAGTTTCTTCCGTCGCTCGGC
TTCGGCTTCGCTGATCGCGTTGTCGATCGTGCGGACACAGAGCTTGCGCCGGTCTTCGTTGAGCATTTGGTCGTGGGCCTTTTTTATTTCTACGATAATT
CACAGTTGTGGTGAGTTCCTCAGCGTGCCGTCGCACCTTCAAAGGCTTCGCGGGCGCGCGGGTCGGGACACTTGTCCGGATGCACCATCCCCGAGAGCTA
CGTTTTGCCCATGAGTACCTTGTATCAAGTTGATAGATTCCGAGACCTTGCGGTAGTGCTGCTTGATGTCTTCGTCCGTTGCGTCCGTCTCGAGCATGAG
CACGAAGAACGGGTTGAGGTTGATCCACTCGTAATGCGGCTGCAGCAGCCGCTTGATCTGAAAATCGGCGTCAACTATAGTCGATCTGAGCAACAGCGCG
CGAGACAGACCACACGTACAAAAGTCGACAATCTTCTTCTCGCGCGGCGCTTCTTCCGGCTTCTTGACCGTGTTGGCTTGGTCCTCGAGCTCTTCGACCT
CGTTCATGAAGGACGCAAGGAGGTCCTCCTCGGCCTTCTTGGCCGCCTCCTCTTCCTCGCGCTTGAGCCGAATGGCCTCTCGCTCCGCGTTTTCTTGGCG
CAGCCGCTGCGTGTGTTCGTCAGCGACCTTGCGCACGTCCTCGATTGCCTGCGCCAGCGACGCGTTGCCCGGGTCCTTCTCGAGCCCACGAAAGTAGGTG
CTCTGCGCAATGTCAAAGCGGCCCAGCGCATGCTCGGCCGCGCCCTTGCGGATGTAGCCCTTCCACCATTCCGGCTTGGCGGCGATACAGGCTTCGGCGT
CGCGCAAGGCCTTGGTCTTGGAATCGTTGGCCAAGTGCGCCGCGCTGCGGTTGCTGAGGTACACGGCGTTCGTCGGGTCCAGCTCCAGCGCGCATGTGTA
GAGGCGGATGGCCTCAACGTAATTCTTTTCCTTGAGCGCGTCGTTACCCTGGGCCTTGAAGGCCTCTGCCTGCGCCAGCGCGGCCTCGAGCGCTTCGTCG
ACGTGCTCCTTCGCGTCCATCCTCCGCTAACACCGTGGGCGTTCTTGATTGGTCGAAAAGGCTGCTGCTTCGGATTGGCCAAAATATCTGCGCGCACCGA
TTGGACCGTTCGAAAGATCAAACCAACCACCAGCCAAAGCAAGCAGCATGTCCGACGGAGACAAGCGAGTCCCGCCGACGACGCAGCGCCTCAAGTACGT
TCATGAGACCAGCGCCGATCGCCAAACTCTCATGCATGTAGCTCTCTGCGTGCGTCCGACGCCAGCGCATCGGCGGCCAGCTCGGCGGCCGCCCGGCGGG
TACTCCGACCTTGCACCATGCATGCCACAATCATTGACCGTGCATGTAGTTTGTGCCCCGACCGAGCCAGCGCCGCAAGGCCGATGGTACCGACGCACCC
GAGCCCAAAATCAAGGCCGAGACGCAGGCCAAGGCCCCGCGCCCTAGCCAGGGTGGCCGTGGCGATCGCAAAGCTGAGCACGGCGGCCGCAGTGGCCGTG
GCAGCGCCGAGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGGACCACCAGGAATGCCACCAAGAGGACCACCACCTGGCGGCCCGCCAGG
AGGACCACCAAGAGGACCCCCACCGGCGGCCCGACCAGGGTGGTCCACCTAGAGGTCCTCCACCAGGAGGTCCACCAGGAGGACCACCGCGAGGCCCTCC
TCCAGGCGGTCCACCAGGAGGACCACCTCGAGGCCCTCCGCCAGGCGCCATGCCCGGTGGACCACCACGGGGCCCACCGCCAGGAGGTCCGCCACCAGGA
GGCCCACCTGGAATTCCGCAACAAGGAGGACCACCTGGGGGCCCTCCGCCAGGTAGTGATTCAGCAACATTGCATACCACTTGCTGTTGGAATCCACGAC
ACGCTGTAGGCATGCCCATGATGGGTCGACCGCCACCACCTGGTACATGCTTTGTACAAGTACTAAGTCATTAACAGTGTCCTGACGTAGGAGCACCTCC
AGGAGGTATACCACGAGGTGCATAATCCCGTTGGATGTCGTGAAAAACGTCTCGAACTTCCATACGTAGGGCCTCCGCCTGGAGGACCACCAGGAATGCC
GCCCCGAGGTCCACCAGGCATGCCACCGCGAGGTCCACCAGGCATGCCACCGCGAGGTCCACCAGGCATGCCACCAGGCATGCCACCAGGCATGCCACCC
CGAGGTCCCCCCGGCATGCCGCCACGAGGTCCCCCCGGTGTGTTGCAATATCTTTACAGTGGGGATGCATGGTTTTGTCAAACATAGGGGCACCGCCGGG
TATGATGCCTCGAGGCCCACCAGGTAGCGTACGATCCAGGCAAGAACGCGTTTTGGATCGACTGATGTAGGAATGCCACCGGGCATGATGCCGCGCGGTC
CACCAGGTAGGCACTAGAGCCCACTTTCCCTGCACTCTCTTACCTCAACATGCATTAGGAGGTCCACCAGGTTCGATGCATGAGTAGTTTATCGTGACTT
ACTCTTTTCGATACAAGGCATGCCAGGCCGTGGTCCGCCTCGCGGTCCACCAGGTTGCCACGTCATCTTGTCGTCGCTTCAGCGCTCACGACCATGTTTC
TCTAGGTCCTCCCGGCATGCGACCCCCAGGCATGCCAGGAATGCCACCGGGGCCTGGTATTTCGTCTTTCGAAAGGCGAACGCGGTGTATGAAAGCATCG
TAGGAGGTCCACCTGGTGCCGTGCCTCGCTTTGGGAAGCTCTCGGTGAAGCTGTTAAAGGGCCTCGAGCTCATGAGCCTTGGGGCGCTTCAAACTGCGGA
CCCGTACGCCAAACTCACGATCGGAACCCAGAGCTTCCAGACCAAGGCATTTATATTGTATTTCAAGTCACGCTGCTAACGTGCGTCTGCCTGTAGGTCC
ACGAGAAGGGAGGAAAGAACCCGACGTGGAACGAGTCGTTCGAGTTTAGCATCTCGACCGAGAAGGAGCTCATCATCGAGCTCTTCGATAAAGAGCAGAA
CGGCAACGACCGCTTCATGGGCAAAACTACAGTCCGCAACGGCATCGCTGAACCCAAGTACTCAACCGACATGTTTAGGTGGACTTGATTCCGTGGATTG
CCAAAGGCAGCTTCGAAGGCGACATTGACGTCAAGGACAACGACCAAGATGCGGGCAAGGTGTCTCTCGTCGTACAATTCACAAAACCGGTGGTCGGTCC
GCCCGGTACGAGGCATAGACATCGGCCTTGCATACGCTTACGCTATGAACCACGCAGGCGCGATGCGCACGCCACCGCAGATGGGTGTCATGACGCCCCC
GGTAGCTGGCGCGCCCCCAGCCGCCCCCGCTGAGCCCCCGCGTGATCCCAACGGCAAATTTAGCGACAGCGAGATCCTCGAGGTACCGGACAGTTCTTTG
CGTCAATGTATCAAGTCTACGTAGGCCTTTCGCGCGTTCGATTTGGACCACAACAACTATGTGGGTGCTGCCGAGATCCGACACGTGCTCATCAACATTG
GCGAGTCGCCCACGGACGAAGAGGTCGATGAAATGATTCGCATGGTCGACCTCGACGGGGATGGCCAAGTGTCGTTTGACGAATTTTACAAGATGGTGAC
GGGCGGGAAAGAGCCGCCATCGGGTCTCTTTGTGGCAGCCGGCGACGGGGAAGTCGCTGCGATCGGTATCGCACATGACGACGACGTGCTGCTGGCTTAC
TTGAATGTTTAGCAACGGGTGCGGGCGCAGCGTCTTCGATCCAGTTGCGCAACGAGCGCAAGAACATTCTCGAAGAGTTCGCGCAGGACAACAATATCAA
GCCCGAGTCGGTCAAGAAGGCCTACAAGCGGTTCCAAGCCACCGACAAGGACGGGTCGGGGCAGATTGACTACACAGAGTTCTGCGAAATCATGCTTGTG
GACCCGTCGCCGCAGTGCGAGAAGCTCTTCCAGCTCTTTGACAACGACAAGGTTGGCCGCATCGACGTGCGCGAGGTACACATGCAGTGGTTCGAAACGG
TGTGGACGGATTGTCTTGTAGTTTA