Description :
From Genome Similarity Track
Location :
Scaffold_1862:3797- 5396
Transcript NameFunction/comments
Phyta_totarag13774hypothetical protein PHYSODRAFT_345031

Sequence
1599 bases(100 bases per row)
GAAGCGGTCTCCGATCCGGGTGGACACCACCTCGTGCATTTGCAGCGAAATGCCCCATTCCGGCTGCTCGAACGTTCGGAACGGCTGCACCTTGAACTTG
TCCTCGCTGACTCCGCCCACACTCGACGATGtctccagcagttcgtcCTTGTAGACTGCGAGCGCAGATTCACTCATGACGATCTGGCCGCCTTGCCCCA
TCTCGCTCATCTCGCGCGCCATCATTTCGCTGAGACCCAGATAGGTCATCTTGCCTGTGATCGGGTGCCTCGCGCACACCAACCGCTCGTCACCGTCGTG
GATGGCCATGCGGACCCGAAGTCCGTTGAACAGCAGACGCGTCCAGATATCGTACACTCGCGCTGCGTTCTCGTATTTGAGCAGTGCGGCGGGCCACGGA
GCCTTCAACAACTTTTCTTGTACACTGACACACCACCCGATGGCGTCACGGACACAATGGAACGCTAGCTGAAAGGAATCACCAGCGGTTGTGATCTCGT
AGCCTCGGAAGCGAGGCAGTTGTTGTCGTAGCAAGTCGTCGTGGATCGACTGCGCCTCAGCCATCGCCTGCGAGTTGTCGGCCCAAAGTCGACTAGAACC
TTCAATATCAGTGACCACGAAGGTCGGCCGTCGTATAGGCGCCTCCACGATCACGTCCATTGTGTCTAGTCCTAGTTCGTCTTGGAAGAACCCACtttcg
aggagctgctcgtaCACAGAGGTTGACATGAGAGGACGTAATGTGCGATAGCAGCAAGTGACGCTAATGCCGATTGCGAACGCTGTGCCTGCGCCAGACA
GATAGTAGAGGATCTGTGTCAGACCCACCCATTCCATCTTGATATCGTCTATGAGACGGACCAATACTTCCACTACGCAGGACGGGAACACGAGCACGCA
GTAAACGATGACGAAAGTCTTGATgcgctggtgcagcagcagcaaagctgGGTCCACAGCACTTCGTGTGCGCTTTTGACGTGAGATCCAGACTGTGGCG
TACAGCGGGTACAGCACGGACGTCCAAATGCACGCCAGCTCGAACCAAAAGGCAGCCGTCTGCACAGTCTCCGACTTGGCGGACGGCAGAAATGCTGATA
CTGTCATCAAGATAGCAAAGACCACAGCCACGGTGTACGCGCGAATGCAGTACCGGCGAATGATAGCGCGCTCGCGCTTGGGTCCGCGGTCCATGGACTT
GATGATCAGGCGCTTCATCTCGTAGGCCAGCGCCGTGATGAGAAAAGTTGTGCACAGCAGAGCACAGTCTCCGATCAgagtgacagtgacagcTACAACC
TTGAACTCTTTACCATCGGAGTAGATTGCCCGCGCTCCCATGagttcgccatcgtcaagcGCATCCAGCGTGTCTCGCAGTCCGTTGAAATTGGTCAGCA
CCTCCACGTAGAGTAGCAGTCGTGCCAGCGAGTAGATGAAGTACAAGCGGCACACCGAATAGGTGATGTACTGCACGGCCGAGTCGCCCACCTTCATATG
CTTgaacgagagcagcagcgtcgtgccagtcgtggccgtggccaCTGCCAACACGATCACATACGTCAGAGTCCATTCGTAGTGGGTCGAATCATCCAT