Description :
From Genome Similarity Track
Location :
Scaffold_373:3796- 5162
Sequence
1366 bases(100 bases per row)
CATCGCATTACAGCAGGGTGTACTACTAGTTGGTTTCTTACCAACGATAGGAGACTATCTAAGAGCCCATTACGCCAAGGATGCTTGTCGGACGTCGATC
CTGACTGGGGAAATGTACTACCAAGAGCTCATGAATAGTACTAGTCCTGTTCGACTGTACCAAGTAGCTCGCATGAGCCCACGCGTGTTTCGACTTCTGC
TAGCAGATCTGGAAGCAACCGGGAGACTACCCTCGACACCCGAAATCAGCAGCGGCCAACGTCTCATGATTTTTCTGTATATATTATCCGGAAAATCAAA
CCGTGACGCCCAAGAGCGTTGGCAGCATGCTGGTGGGACTATCACAGAAACTGTCAGACAAGGCATAGCAGCAGCGAAAGAGCGCTACAACGACTACATC
AGCCTCCCAGGGACAGAAACACCACAGCTCGTCAGGGAATCGCCAAAGCTCTTCCCCTATTTTGAAAATTGCATCGGTGCTCTCNCCGTTGCACCTATGT
TAATTGCACCACGCTTCAGAAATCGGAAAGGGTTCACATCCCAAAACGTACTTGGAGCGTGTGACTTTGACATGAATTTCGTCTAAGCGCTCGCAGGGTG
GGAATGATCCGCACACGACGGTCGGGTTCTCAAAGATGCAGTACGACATGGATTTTGCATTCCCGAAGGTAAATACTACTTGGGTGACGCTGGATATGTT
CTAAACAGCTACANGTTGACGCCATACAGAGGGACAAGGTATCATCTTAAAGAATTCGCGCAGGGTTCGATGCGACCACAAAACAAGAAAGAACTATTTA
GTCTGAGGCACTCATCTTTGCGGAATGTCATTGAGCGAACATTCGGAGTGGTCAAGAACAAGTTCCCATTCTTAAGGCCATGCCTTCGTGTGAATTGAGG
GAGCAGATAGGATTTGTTCAAGCCGCATTTGCTATTCACAACTTTATCCGCATGCACCACGACGAATTTGCAGACAACGATGAGCTCGCACATGATgcag
tcgacgacgacatcaaCGGAGATACACAAGCCACCGACGCTGATTGCACTAATATGCAAGATCTCCGCGACAATATATCACAAGCGATGTGGTGCGAATA
CATGAGAACACTTGCAGAAAGGCATGGTGAAGTAGTCGTCTAAGACAAGAGGTAGCACGAGTCAAAACACAGGTAGGCCAAGTGATGGACACCGACAAAA
TAAATAAATATACGCTTACAGAGGTGTCGCAGCCAATCCGCCAAACTGATCCGCTATCTGCCCAAATTTGAGCGGATCTAAACCGCTAAAATCCTCGTGT
AAATCCGCCAAATGTGTTCAGCGAATAAAATAGCGGATTGACCGATCCGCTATACTCAACAAATCC