Description :
From Genome Similarity Track
Location :
Scaffold_205:37958- 41868
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_205-fgenesh-gene-0.10Anoctamin

Sequence
3910 bases(100 bases per row)
CGCTGTGCTGCGCGTACGCGGCCTCGTGCGTGCGGTGCAGCGCCGCGATGCGCTTCTCGTTCTGGATCCACGTCGGCACGTCCGGCGCCGCCCAGTTCAG
CAGCACCTTCACCAGGAAGATCAGGTGCTCACACGCCTGCAGCACCCAAAGAGATACAAATTAGCAACTCACCCATTGAAGCTCCTCGCTCGCTCCTCCA
CGTCAGGCTAGCCAGCTAGTGAGTATTAACACGTACCACGATGAACATGAAGCGGTGCAGGTCCGACCAGGACGGCAGCAGGTCGTCCAGCTCGTACGTG
TACACGAGTGCAAAGTTGATGATCACGGCGAGCACGGAGAACGCCACGAGCACGTTCTCCCAGACACCGATGCCTCGCGTGTGCTGCACGAGCGGCCGCT
GGTAGCTGTGCGTGTTGACGAGCTTGAGAAAGTCCGAGCGGCTCTCGACCACGTTATTGAGCCACGCGAAGACCGGTGCGAGCGGGAAGATCGGGCTGTA
GAGTGCCACGTACCCGTACTGGATCATCATCTCCTTGTAGTCCGCGAACGTGTCCTTGTACTGCGCCTGGCGTTTCTGCATGAGCACGCGCGCGAGTCGC
TCCTGCACAGATGCCTGCGACGTGTGCTGACGCTTGAGCTCCGGCATCGCGCGCAGCAGCGTCGAGCGATTGTCATTGCCATTGCCATTGCCATTGCCAT
TGATATTGTTCAGTCCCGAAGACGCTTTTGTGACTGAACTCAGCTGCTCCGAGGAATCTGCAGTGCTCATGCTGCTACTGCATCGGCGTCTCCGCTTGCC
GTCGGCCGTGAGAAATTCGCCCGTGAGCGAGACCACGAACGGCAGCCCGACCTCCTTGAAGTTGTCGAGTAGCTGCATGCCGACCATGAGGATCCAGAGC
CGCTCGCGCACGCGCTCGAGATTCTGCACGTAGAACGCGAGGAACCAGATGGACGCGTTGCTGTTCACGAAGTGGAACGGCATGCGCTTGAGCACAAGAT
TGTCCTCAAACTCCTGCGCCGTGCGGTAGTTCTCAAACTCGTTGAGCTTCCACGCCAGCTGCTGGTACATCAGGTCCATAATGTAGATGATCAGTGCATT
GAGCACCCCGGGACCGTGCGAGATGAACGCGCAGAACGCCGGACTTGGGCCTGAGATGGAGCCCGCGCCTGCGCCTGAGCTTGAGTGGTGGTCGCCACCG
CCATGATGCGGGTGAACTGCGTGCTTGAGATAGCACGAGCGGTAGTGCGAGCGCAGGTTCTCCGACAGCATGTTGAGCCCCACGACGTAGGCGCCGACGA
CGCAACACATGGAGAGTAGCAGCGGGATCGCGAGCAGCTGCCGGAACAGGCGCTTGTGCCGTGGGAAATCGTAGATGTATTCGTGTGTGACCGGGTCGTT
CATCCACTCGCCTTTGAACTCGGGTCGAGTCTCAATGTAGTCCATCCCTACGAGCCCTGGCACGAGCGACGTCCCCGAGGGCTCCACGGCCTCCTGGTAC
TTCCACGTGTACTCCACTTCGCGCTGCTTGCGCTTCCAGAGATCCACGAACACGGACGTGCCAATCGCCAGCAGAAAAGACAGCAGACTGTAGCTCTGCG
CATTGAAATGGCCTGCCGCATACACGCAAACGCCGCAGATGCTCGGAAACACGAGCATGTTGGTGTAAAAGTCAAGCCACGCGAAATACATGGCGATCTT
GGGACCGTAGTACTGGTAGATGTCGGTGAGCGGCGGCGCGTAGGTCGCGTGGCGGGACCATTTACGGATCATACCCTCGCGGAAATCGTCGCGGTGCAGC
GGGTACAGCTGGATCGTGAGGTCGTCGCGTTGCGCGAGCTGACTGAGCACTTTCTTCTCGGCCTCGAACACGAGCTCACCGTTCGCGAGGAAGAGGTTGT
GGTCCGTGCGGCACTCCTTCAGGATCAGCTTCGTGAGCTGCTGGGTCTGCGCAAGCCCCGCGAGCGGCAGGATCTGCTTTGTGTACGCCGGGTGCAGTGT
CACCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTGGTGGTGTACAGGCAGCGCGTGGTGGTGCACCTGGCGGCCCTCTGGGATGCTG
GAGGTAGCCTTGGATCTTGACTTGGAACTATTGGAGCTGCTCGTGGTATTGCTGGGCTCACCGTAGCCGACGGTCATGACGTACGCTAGCGCGTCGCTCT
TGGACTCCGGGAGCAGCTCCGAGTCCGGGTGCTCCAACGGGTACAGCATCACCTGGCAGCCGGCGTCGCGCAGCAGCATCGCCGTGATGTCGATCACCAT
GTGGACATCGCTGCTGCTGGTATGATCAGTTGGTGTTGGCGCTGCTGCGGTCTGTCGCTCGCTAGAACTGGAGCTGCCTCGACCACTCTCGTCATTATCA
TTTGTAGTAGGACTATCAGCATCCCCAACATCCATTGGACCTCCAGTATCTAAGGGACTGAGCGTGGAGCTTGTGCGGCGGCGCACCCAGTCCTTTATCA
CCTCTGTGTTCGACTTGTCCGCCTCGATGGTCTCACGTGTGGCGATTTCAAAGTAGAGACAGAAGTCCGCTTCGCACGCCACGTCCTGTTTCTTGAGAAA
CCGCTGGAGGAAGATGCGCGAGACGCGGCGCCGGATCGTCTGCGGGAGCTTCTCATCGTCGGACGAGTCGCTGTCAGACGACGACGCGTCGCTCTCGGAG
CGGCGCTTGATGCGCTCGAAGAGCGGTGCGCGACCCGTGGAGTTGAGAATGCGCTGCAGGATGGACGCGCGGCGCGCCGTGGCTGGGATCCGCACATGGG
TCTTCAAGGGCGAATGATAGCTGCCATTGCTGCTCTTGTGGTCCCGACCGCGCGCTGCTGGCTCCGGATCGGAGGATGATGAGTGCTGGTGGTGGCGACG
ACCTCGGACGCTACTGGCACCGCTGGTATTGTCGCTGGTGTCTCCGCGCAGCCGGCGCTCCAGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCTCTCCTTGTCCTTCCTCGCTACCATGACGATTTGTGGGAGAATGACGGACGGACGGACTGATTTGCCGAATACGGTATTGACACGCAGGTACAAAC
CCAAAATGTGCAATATTCTCTTTCATGGTCAGAAACATGCTGCATGATAGAATTTCTCTCACAGAATCGATCCTATCATTCAGCATGTTTTGGCCTATAA
AAGAGTATATTGTAACTATTGTAACCGGTATGTAATATAGGTCAGTGATGACTAAATTAGGCCACTTGTAAATGTCTTCGAATAGGTTGTTGCCATAGAT
GCTTAACGTAATGTATTACGGAGAATCTAACAGGTTGACGCGCTATCTATACTTACCTTTGGATTACACATTGCCAGGAGAGATTTTCTAAGCTGCGCAT
AAGGAAGTGTCCGCAAACGTCGAATCTGTCACTATATACATATAATTATTTATACTATACTACAAGTATGGCAAATAGCCAAAATACACTATGGGGTTAT
TCTGCTGTTTGCGGTATTCATTACGAGACTCTTGAAACGACTCTTTCTCACGGAAAGCCTTTGAAGGTAGAGAAGACCTCCACATGGCTGGTTGTGCGTC
ACATTGCTGGCAGAGGCCCCCTGCTAACAATGAACTTACCAGCTGATTGACAATGGTAACAACCTGGGTACATGCACAGTACTACTAGTAGCCACCACGT
ACCAATTGCGACAGAGAGCGCCACATACACACACGCACCTTCGAGCATCTACCCTCTGGGATCAGTCGTCGTGGGATATGGCTCCTTCACTTCCCACAGC
ATCGACGTCAGACACGTCAAACACGCCGAAGTTTGCTGTGCAATGTACTTCTAGTGGAAATCCTATTTCACGCTATATGCACCTCACTCGCTCTCGAAGC
AAATAGAAAG