Description :
From Genome Similarity Track
Location :
Scaffold_36:379457- 383902
Transcript NameFunction/comments
Phyin_T30-4PITG_14612NADH dehydrogenase iron-sulfur protein 8%2C mitochondrial
Phyin_T30-4PITG_14613Putative uncharacterized protein
Phyin_T30-4PITG_14614Tubulin-specific chaperone C%2C putative
Phyin_T30-4PITG_14615Putative uncharacterized protein

Sequence
4445 bases(100 bases per row)
ACCACCGCAGCTCCTAGAAGAGCCCCAAACTCCATTCATTCGCTCTTATTTTTCTTTGTTATAAAGACACCCCACTCGTCAGTCACAAAACCATGATGCT
ACTTAAGTGCATCACGATCCCGCAGTATGCAGCGTGCAGAGTCTCCGTTTGTGTGTATGTGTCTGCTTAACGGTAGAGCTGCTCGACCGAGAGGTTCTTG
GCAATCTCGAACTCCCACTTGTCACCGTTTGCCAGAAGCTTTGCCTTGTCGTACAGTAGCTCCTCGTGACTCTCAGTGGCGAACTCGAAGTTGGGGCCTT
CGACGATGGCGTCCACGGGGCATGCCTCCTGGCAGAAGCCACAGTAAATGCACTTGGTCATGTCGATGTCGTAACTTGTGGTACGGCGGGCGCCGTCCGC
ACGCGGCTCCTGTAATACACAAAGTTAACATCTTGTCAGCGCCACTTTTCCGATCTTTTTGACAATTGTAATACTCACCGCTTCAATGGTAATGGCCTGA
GCGGGGCAGATAGCCTCGCACAGCTTGCAGGCAATGCATCTATGGGTCAATTAACAACAGATACAAAGAATGAGAACGCGACTTTTCATACAACTGACCG
CACCACCAGAGCGGAGCCACTCACCGCTCCTCGCCGCTCGGGTAACGACGCAGCGCGTGTTCGCCACGGAAACGCGGGCTAAGCATGCCTTTCTCATACG
GGTAGTTAATAGTAACCTTGCGCTCAACGTGCACTTCCCAAGCCAACCAGGTGGCACGGAACACGTCCGATAGGAAGAAGGTGTCGGACATCTTCTCGAT
CACCTCGCCCCACGTAGGCTTGGGATCCTGTTTGCCGGGCGCGGGGATGTTCGCGAAGCCGCGTGTGCTACCGGCCACAGCAGCGGGCGCCGTGCGGCTC
AGGCTCTGCTTTGCGGCCACTGCCGCGGCCGATCGACGCAGCACCATGACGTTCATCGCGTTCCGGTAGTGTGGGGAGCTGTGCGGTCTGAGAGCCGCTC
GTCGCTGACGCAACGTTAACGCAACTTAAGCTTATGTACTGAAATAACAAAATTATACTGGTGTGGACAACACAAATTAAAACTGTTGTGTTTTCACTGG
AAGCGAAGCCGCCATAGACCTGTTGGTGTCAAAGCGCGTGCACAGCAGGATAGCAGCAGTAGGATGGCGTCAAACGCGTTCGTGTTGTGCAAAGTCCGAC
GCAACGTGAGTCTGTCACCGTGTCATGCCGTGGATGCGCGTGTCGGCATTGAACAGAATCTGACGGAGCAGCTCATGCGCTACTCGGAGGCTCTGCAGGG
TGTGGTGCTGAGCTTCAGTAACGTAAAGCTGGACAGACCCTACGGAGCCATCGTGAACGAAATGCCCTTCATTCATTGTAAGGTGCTGACCGATGCGTTG
GTCTTCCGTCCAAAGGAAGGAATGAAGCTGCGCGGCGTCGTCAATAAGATCGGCAGCAACCACGTCGGAATGCTCTTCGCTGGTGTCTTCAACGGCTCCG
TGGCTGAAGCTGAGTTGCCCAAAGGATACGTGCACAACTACGCTCAGGACTGCTGGTAAGATTATTGCAGGTATTGCGCGTATGCAGCTCTATTATTTAC
AATGTGCGTTGGTATTCGTTGTGTAGGCTGGGCGAGGACGGCTCCTCTATCTCTGTTGAGGATGAGGTCGAGGTCAAAGTGCTGCGGTGAGTCTAACACA
GAATTTTTATTATTGCAGGGCATTGTACTGATACTGGTGCAAAAAATATTGCTGGTTTTGCAGTGTCCACGTTGCTGGCGGTATGATCGCTATTGAAGCC
ACGATGCGCTTTGACGCCGCTGGCGTTGCGAAGACTACGACATCAAAGAAAGCGAAAAAGGCCACGCATCTTAACCTGGCAGCAGGAGAGCCAGTGACCA
AGCCCACTAAGAAGAAGAAAGCCAGAAAGAGCAAACAAAGTGAGGTGGAAGTGAAGGACAAGAAGGAAACGAAGAGCAAGAAGCGCAAACACGAGAAATC
TGCTGATGAAGAGGTAGCAGAAGATGCAACAGCGCCTGCTGTCGATAAAGTGAAGCCTAGCAAGCACAAAGACAAAGACGCCAAGAAGAAAAAGCACAAG
AAGAGCAAGCACGACTAGACTTAACAGGGAGGCGAAACGATAGATGGATACTTGGTTTTAAGTATCTAGCTGCATGTGTTTATATTCTTTCAAAAGCCGT
TGTCTGCGACCTCACTTCAATCTGCACACAGCATGCGACCCGCCTCATTAAATAGGCTACCGGTAGTGCGCTCAAAGCCTGGACTAGTCGTACGAGATCA
GCTTCTCCAACTTCACTGGGATCTTCGGCAGTGGCTGTTTGGGGTCGCGGATGCTCCAGTTGGGAGACTGCTGCGCTTTGTGCCACTTAAAGTCGTTCAC
CTTAGCCCAAAGACCCGAGTCCTTCGATACACCCAGACGTTCTAGCTGTGCCTTAAGTCCTTCAAACTGTAAGCGGTACGGCCCGAACTGTATCTGCTGG
CAATCCTCAATGATAGGATGGCTCGGGATGCGGAGATAAAAGGTCGTGGCAGTGCTCAAGTGGACGCGAAGCTGGCGACATGCGACGAAGAACTCACATC
CGTTGCAGTTCTCAAGCCACAAACTGCCGAAGATCGCTCCGGTGTAGAACACGCAATTCTTCAGTGCATCGCCACGGATGGCCGATGTCTCCACGCAAAC
CAGCACAGCGCAGTCGGATAAGTGCGAGAAGTTGAGATCGCGACGCCGGCTGTCGTCGGTGTGGGCGAAGCTGCTGCTATCGATGACAATCACCTCGTTC
TGCTTGTTGGCATGCACCAGCTCGTCAAGTTCAATCGCTCGCAGTGCAGGCGACGAGGCCTGTTGATTTCCTGTTGAGTCACTCAAACCTGATGACTCTG
GCTGGTCTTGTCCCTCCACTTTTATAGCTTTTGCTCTTTTCGCAGCACGTGCTCGAAAGGTGAACTTTTTCCTGGGAGCGAATGTCGTCCGTGTTGTGTC
AATCAGCTCCAGTAGCTTGGACAGGATCAGCTGCGTGTGACGAGTGTCATACGGAGACAAGTATAACGATGATGCTGTGGCAGCAGCATCTCTCATGGCA
TTTACCTCGAGCACCAGCGCGTCCAGCTTAACCTCTTTGGCCGGATCACACGGCAGCGGTTGCTTCTTCTGCTCACAGAACACCCCTACCTGCTTGCGAA
TGTGAGCCTCTTGTTGAGTAAGCTTCTCCCAGAACGCAGTCGCCAGCTCATCCGTCGTTAGCTCTCTATTCAGCTTCAAGACATCCTGTGTATCGCCAGT
CGCGGCGTTTCTCACCTCTTGTTTCTCCTTGCGTCGCTCCTCCAGCGCATGTGCCAGACTCTCCTCATGTGTCGTGAGTTTGGGGAATACACCGTTCGTG
TTGACCCTCTCGGGCCGAACAATTGCGCCGTGCAGCGGCTTACAATCAAAGTAGCGCCTGCCCTGGAATGACCCGTCGCCTTTGCCCAACGGTTTGTCTA
GCCGTACTCCAAGCCAGCCGTCGCCCGGGAGGCCCTCGATCGTCCCAATGTACGCGATCTCACCGTACCGTTTGATACTAGAGCGAAGACTGCCACTTGG
ACCCAGGGACAGCAGTTCGCAGCGAGACCCTATTGCCGCCGGTGGCATTTCTATTTAATTAGGGCCGTTCCTAATCGTTTGCGTCGCTTCCTAAAATCCA
GGGCAGAATCCGGATATTTCAGAGGCTTTCATCCTAAACTACCGGTACCAGAACCGGTACTCAGATTGTAGTCAATCTCACAACATTAAATTTATGTGCA
CCACATCGACCGCCCCAGCTATTTTGATTTTTTTGACGAATCGCAGATCAGCAAATATCGAGCCAATCAGCGTGCCATCGCAACGTAGGTACAACTTGTT
CTCCCGAGTGACGACTCGTCACTCCGCTTTTCACATTCCCTCGACGTCCAAGATCTCAAAGCTACGATGTACCCTGGAGGAGGCCAACCACCGCACGGAT
ACCCTCAGCAGCCCGGATACCCTCCGCAACAAGGATACCCGCCCCAGCAAGGATACCCTCCCCAGCAAGGATATCCTCCCCAGCAAGGATACCCTCCGCA
ACAAGGATACCCGCCTCAGCAGGGTTACCCGCCTCAGCAAGGCTATCCACCTCAGCAGTACCCCCCGCAGCCTGGTTACCCCGCGCATGGTCACCATGCC
CCGCAGCCCGGTTATCCTGCACACGGCCACCACGCACCTCAGCCCGGTTACGCCTACGCCCAACCTGCATACGTTGCGCAGCCTGGCGTTGTGATCGCCG
GTGGCAAGATGAAGCACGGTAAGTACAAGCACGGCAAGCACAAGGGTCACAAGTTCAAGGGCCACAAGTACAAAGGTTTCAAGGGCAAAGGCTTTAAGAA
GATGGGTAAGAAGATGAAAAAGATGTTCAAGTAGGTGTGTTCGGT