Description :
From Genome Similarity Track
Location :
Scaffold_192:37928- 44284
Transcript NameFunction/comments
Phyta_totarag5362hypothetical protein
Phyta_totarag5363hypothetical protein

Sequence
6356 bases(100 bases per row)
TGAATTGCTGCAAATTCAGCAAGTGAGTCGTCATGGAAGCAGGTAAAATAGAgcttttttttttcaatCGAAGACGTGCTCATCTAGTCTCGATGGCACT
AAAGCTAGTAACTGGTGCATTCACACAGGTTCCCAACCGACAACACGATGCGCGAGATCGCTGATCTGCTGTATAGGTTGCAGGCAAACTACTCGAGCGT
GCTCCCTCAGTGGTTGAAGGAGTACTCGCTTCCTTACAACCTGACTGTTGCAGGCGTTTTGTCGTCTACCGGCGTTGATGAGCTCGCAGCTTATGGGAAA
CGCACCCGAAGGTTAGTGGGCTCAGCCATCCCAACGATCTACAGTGAAAAGCAGTTCATTCTTGCGCACACGTTCAAGGCGCGCACGGGAGATAGTGCCA
GAGCGTAGGGTCCATGATTTTTCGAGTTGTTTCACGACTGCATTCACGATCACGGAAGCGCTTAAGCTATTTTTTCTGGTTTTGATTTCCATGACAGGTT
TGCCAGCACGTTCTTCGATAACCCCAAGGATGTTCACTACATTGAATATGCCCAAGGAAAAGTACGTTCACAAACACATCTTGCTTAGGACAACTTTCAG
TCAAGCTAGCCGTACCAACGCCATACCACCTCTTTTTCTGCTAGGACCCGCTCATTCGCTTCTATGACATCTGCGATCGCTACCTGTCGGAAGTTAAGCA
CAATCCGAATGCTTCTGCAGAGCTACGGGCCTACGGTAGTTCCAGTCAAATGAACGCCAGCCTGGCGAAcctgaagatgcagctgaaTATTCCTGATAGT
GCGGatctcagcgtcgtcgatATCCGTGCAGCCTTCGCAGCTTGCGCGTAAGTGATCGCTATTGCATGATTACTTCGATCCTCTTGTTAACATTCCTATT
CGCCAGGTTTGATATCATGGTGTACGGCATCACGAATCAGTGGTGTTCGCTTATGGATCAAACGTTTTTGAACCGACTCGACTACGCCGAAGACCTTGAA
GCTTTCTACGAGCAGGGAGCCGGGCACAAAATCAACTACGAAATGGCTGCCGTCCTGCTTCAAGATATCTACGCTTTCATGAAAAACTTCATCACAGGCG
ACACGACCATCGTTGGCAACCTGCGCTTTGGCCACACCGAGACCACACTGCCACTTATGACCTTGCTCGGTTATGGCGATCGAACTAAGCTGCTGGCTTC
GTGGACAGACGACCAAATCAACTCACGAGGCTTCCGCACATCGGTGCTCTCCCCCACCGCTTCCAACATCGACTTCCGTCTATATCGTGGCAAAACGGAC
CTGAAATACTACGTGTCCGTGTGGATCCAAGAAGTTGAGGCCCCACTACCCGGATGCGACGGTGAAATGTACTGCGAACTATCCAAGGTGGAAAAACTCT
GGAGCTACTACCTCAACGACTATAACTTCAAAGCGGACTGTGTCATTCCAAAAAAGCGCAAGAATCCCAAACCGTAGCAAACTCGAAGCAACCAAAAGTA
TTCATAAGGTAACAATTCATCGTGCCATTTGTGCTTCAGTTTGTACGTTTTGAAAGGCTATGAGCTGATTAATCTGGATAGAAGAGAGGTAAATCATCTG
AATGCCAATGTGGAGCTTGGGTTTCTGGAAAAATATTATTAGCCCTGCTGTCTGACCGTGAAGTCCGACACCGGCACGTGGGTAAGTACGAAGTCGTGGT
AGACCACGGCCGACTCAGCATGCTTCATCCATAACGGGCCTCTGGGTAAGATTGAAATAAAATATTGCAACAACCTTACATATAGTAAATAATTGAGAGC
CCCCAATAATTAATATTTTTTTTAGAAATATTTTTTGGATACCCTAATTATTTACTGTTTTGCAATatctttttttttaaataccACCGGCATAGCATGA
TTTTGCTCTATGTAATGCCCAGGGTGCGGTTAATGAATGGCGTTACCGCACTTTTAAAACGACCATTTATTTACAATCTGACGACAGGACTTCCCGCCTG
AGATAGAGTGGCACAGGGGCGATTCGCGTATTTGCCTGGAGCCAAGAGTGGTATCGCTGATGCTCTCAGTCGACTGCCTAATCGCAAGCCAGAAACGAAG
GAGTTCCACGACTTGCTCGTTcccagcttcaacgagaccAGTTACCAGTTACCAACTATGTATTGCAGAGATCAAGCCCACAAGCGATTTGATGAAGTCT
GCGATCGTTGGTTACACGAAGAGCAAGGTCCTCCGTGAGATTCATCGTGCGACCAAGAAGCGTAGTACGACAGTAGAGTGTTAGAGAAGCACTACAAGCC
GtacttcgaggagaagaatCTGATCGGGTACCAAGGTTCCACAAATGTGAAGCCTCGGATCGGGGTCCCGAACATCGTGGCACTTAAGTATCGCATCATA
GCTGAAGTACACGATTCCAACTACGGAGGCCATCCTGGCACGGATCGAATATACCTGAAGCTTCGTTCCGACTGGTATTGGCCACGGATGGGGTGCATAC
GATTAAGAAGTACATTGCCGGCTGTGAGGACTGCCGACGAAACAGGCCCCGACTTGCGACGACTCCCGGGCTCATGGAGCCGCTACAGGTCCTGGACGAG
CGGTGGCGTTCTATCTCGATGGATTTCATCACGGACTTACCAGATACGGAACACGGGCATAACTCAATCTGACTAGTCGCCGACCGACTGACCAAGCGCT
CACGCTTCAtcacaacgacgaagacagtATCGGCTAAGGAGGTCGCTACACGCTTCATTGACAACATTTGGAGACTGCATGGTATGCCAAGACATCGTAT
CCGACTGTGACTCCAAGTTCGTCTCTGGGTTTTGGAGCCAAGTCTTCGAGGACGTCGGAACGAGGCTCAAGATGACTATAGTGTACCGAACTCAAGGCGA
CGGACAGACAGAGCGTACAAACCGAACCGTCGAGGAGTATCTACGTTGTTTCGTGTCCCCAGGCCAAGACGACTGGGACGTCTATCTAACCGATGCAGAG
TTTGCAATCAACTCCGCGGTCAACTCAAGCATCAAGACGTCTCCATTTGAGGCGTACGTTGGAAACGTACCGCATAACCCACTCGCCGCAGTCGCTGAAT
CACGTCGACGAGGACTGCGCGGAGGACGATGCCAAGGTGTAAATTTCACGGAGTACCAAGTAGCAGGGCTACGTCAGTGTCATGACGCTTTGGAGGATAC
TCAAGCACGCATGTATGATGTTTACGACAGCAGCCGGACAGAGCAAGTATTCGTGGTCAGTGACTGTGTGTACTTGAGCACCAAGAACCTGGACACGGTA
CACACAAGCTTCTCAAACTCGCTCTAGCTCGGACCCAAGTGAATTGGCCCGTACTCCATCGTACGCAAGGTCCACAAGCACGCATACGATTTCACTTGCC
GCCAGGACTCAAGCTTCATCCCTTGTTCAACACTGGATCGCTCAAGCCGCACGAGTCGCCCACGCGACTCTCAAGACCACAGGAGATGATCTTGCACGAC
AGCAAGGTCGGGCAGATCGTGGAAAGCAGCCATCAGCAAACGGAAGAAGTACGGCGCCATACACATACACTACCACATTAAGTGGGTGGTtgaggagaag
gcgacgtGGGAACGGTCGAGAACCTACATCAAGTGACGGGTCACGTTCAAAAGTTCGAGGATAAGCAGCCCAAGAGATCAAGTAAGCGACGGCGTGAACA
TCCCAAGGACAACAGCGTAGCTCGACGGACGAGTCGCCAGCTCAAGACTTAAAACTAAATCCTGTACAAGTCAATCAAGTCGCCCTTGGCCAAGTGGTGC
GGAATACATCAACTAATAGGAAATATTTCACTAAGGATACGTCGGTTACGTGAATATGTATCCATGGCATCGAAGGAACACAAGAATGAAGTGCAAAATC
GACAGCTTTATTTGTAATTATACAAAGTCTTTGCGTCGCAAGTTCTCAACTCTCCTTCGCGAATTTCCACACGCCGCACAAAGAGGAGCCAGGCAAGGCA
CGACACGCAAACTCGCGCAGTGCCTCACTGTGCGCGTCAGCGTCGGATGCAAATATGCCGGCAGGGGTGACCTCCAGGAGGAAGGAATAAGCCCGGTGCA
GCGGGTATGGGTGGAAACCAGCACACACGTACACGCGAATGGGTGAGTCCATCGCCAGGAGGTGCGATGTCGTGTTTGGCCCTGTTATACTGTCGGCGTG
TAGGTTAGACTTGaggacatcttcatccagctgcAGGTTACCCAGCCGCGCGGTACGGCGATTCGATCACTTCCCTAATTGCAATAGTGTGGGCCATACA
ATATCCGATGGGTTGTTGTGCGTTCGATTGACGCTAGTCACAAGCGCATCAACCAGCGCCGGAGACGACCAAGCCGACAGACCAAGCGCGCGTGTGGCAC
CAGCAATAGCGACGATGCCGCAGAGACGACGGTGGTCAGCGTCGATTGGCAGAGGGATGGCAAGCTCACGGCAGTAGCGGTTGAAGGAGATCCCGCGGCC
CGCATCTTTCCCGTCGTCAACCACGCGGATGGCGTCGCTGAAGTCGGAGCGCTCAGCAAGGAGCCATTCACGTGGCTCGCAGGTACGATTAGAGGAACCA
GAGTATCCCGCTCAGATGACTCTGTACTCATAGACTCCAAGCGCCCCGCGGCGATCTACGATAGACCAGACAGCGCACTaatgctcagcagcagcggcac
ggaCAGCTTCGGCGGCTTGACGTCACGCTTCAAGGAAGCGAAGGCGTAATTGGCGAGACAGACGACCATCAGTCGAGTTGGCACCATTCTGAATCGGGCG
AACCATGGCGATCCTATGCGCAggctcaagaagcagaatGACGGAATCTGCGGCGAGAAGAGGCGAAGCGACAGGAAGCACAGGCGCAGTGATGGAGGAC
GATCAATATAAGATAGAAGGCCTATTTTATTTGGGGGGGTTACGAATATCAGGTTAGTCAGTTAGGACTGGTATTAGTTTATGCAGGGATACGTTTTAAT
AGAGGAAGGCGGCCTACGATGTTGTGGCTGCCAGGCCTTTGGCAGGAACCACTTTTGGTTCTTCGCCCGCCTCCCCAAGCCTCGCCTCCAGCTCTCGCTC
CTCCACTTGTGTGCAGTTTGATATACTGCTCTTCTATCTCTTTCTCTTTAAGCAATACCAATATATTCACTTTACAATCTTCCTTCACTCTAACACACCG
GTCTCTCTCTTTCTGCCCCCAAGTCGATGCCTCGACACGCCGACGCTGGTgcctcttcaacttgtcctCCATTGATACCGATTCTGCGATCAGCAAACAT
CGAGTTCATTGGCTCGTCCTACTCTGTACGTCGAACATTACTTGGTATATTCCCGGTgcgggggaggggggggggggggggggggggggtattcCCGCCG
GTAGGCAGGTAGACGGGGCGGGACTAATAATACTTCCTTGTATGTCATTGCACGCATCAATCAACACGTTCGACACGCAGTCCTCGACTAGGATCTACTC
CTGGCCTGTCCTTTATACTTGACCTTGCATTTTCCCTTGCTCGCCTTCAGTGATGCATTGTGTTCCATGCGCGCTTGCTTGGGTGCGTCCAGAAGTTCCG
GCGGCGCACCTTGTACCTGTCGCTTCTGTCAAACTCCATCTCGGGACAGTCGTCATTGACATGCGAACCAATGTTGTACATGAAGTTGAACACACCACCA
CAGTAGTAGCATTTTCTTGCTCCCACATTGAGGTGGTAGTCTTCGATGGGCTCAGCCGTTTTTCTCTTGCCAGGAGCACTGCCCCTGGGCTTGGCTGGCG
CCGCATCAATGTGGTTGACCACCAAATCTCAGCCTTGCTCTTTGTGTCAAAAATAGCACATAGCTTGTTATTCACTTTGTCGAGCGTAAGCCCTTCGAGC
GTAAACTAGACAGACGAGCCGCACAGATGCTCCGGTAGAccgcccagcagcttgatcagGGGAAAACTATGGAGATCGAGGTTACGGAGATCGAGGGTGT
GAAAGTCGTGGGAAGGACTTAAACCGAAATAGGTCATCTAAAACAAAAAGATAACAATGACAATCCAACCCATTTCAAAAATAGTCAAATGCTATGAACC
TAAAATAGTCCAGGAAGTTGCAGCTGGCAAAACTGCTGAAGCTACGTCACTCCGCAAATATGGCGACGGCATCGCCGCCCCCCTCTCGGTTCTCCATACC
GCCTCTGTCCGAAAAAGCGTATGAATCgtacgacgacgccgaggctGCTCTTCATGTCTGGAATCATAAGCAAATAATCGACGTAACTAAGGAGCACAGT
AAGAGAAACAAGTCGAAGGAGATACGACAGCCCGACTTGAAGTGCGACGAGTACAG