Description :
From Genome Similarity Track
Location :
Scaffold_33:379279- 383233
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13556strumpellin
Phypa_INRA-310PPTG_13557serine/threonine-protein phosphatase 2A regulatory subunit B'

Sequence
3954 bases(100 bases per row)
GAAGGAAACGTCGGAGCGCATGGAGGAGCTGAGCGAGTATTTTTCCGGTGAAAAACCGCTGACTCGTGTGGAACGCAACGAGGACCTTATGAAGTGGTTT
AAGGATTTGGCTGAGAAAGTCAACAGTTTGGACTACGTTGATCACATCAAGGCTGGGCGACGAATCAAGCGCCTGATTGAGGCTCTGGGTCACGTCGAAC
AGTTTGACCAGATCGACACGAACTTGCAAGTGAAGGCATACCTTGAGGAATCTCGCGAATTCCTCACTGAGATGGTGCGCACCGTGCGTATTCGAGATGA
GGTCATGGGTATTATCGAGAATGTGTCGGACTTGTCATACGCCTGGGAGATCATCAACGATTTCATGAAGATCCTGCACCAGCGCGTAAAAAACGATCCG
TCTTCTGTTATCCTGCTGCGTGCAATGTTTCTGAAGTTTGCGTCGATCCTGGATGTGCCGCTTACGCGTATTCATCAATGCGGTTCCGAGGATGTAATCT
CGGTGGCTGAATATTACTCGGCCGAGCTTGTGGACTACGTACGGCGCGTGATGGAAGTCATTCCTCAGAGTGTCTTCCGTATTCTCGCGGGCATTATCAA
GCTACAGACTGACCACATGAAGCCAATTCCTGTGAAATTCGAGAACACCCTCCTGAAGAACCACGCCCAGCTGAACGAGCGTTATCGTCTTGCACGTGCT
ACTAACGAGGTCTCCAAATACACGGAAGGTATTCTGGCGATGAAGCGAACGCTACTTGGTATCATCGAAGTGGACCCTCGACAGGTACTGGAAGATGGGC
TGCGCAAGGAGCTCGTGTACCGCGTGTCGCTCGCTTTCCATGAGGTGCTAATCTTCGAGAAGAATACGTCTGAAGAGTGCAACGAGATCTTCGTGAAGTT
AGCGTCCAACCTGGATGCCTACCGTCTCTCGTTCGAATACATTCAGGACTACATCGGCATTTACGGTCTGCGAATGTGGCACGAGGAACTATCGCGTATT
ATCAACTACAACGTCGAGCAAGAATGCAACCGATACTTGAAGAAGAAGGTGTACGACCGTGCATCGCAGTACCAGAGTCGTGCTATCCCGATCCCGAGAT
TCCAGCCGCCGTCTGGTGACATGAGTGTCAACTTCATGGGCCGCCTTATGCATGCGCTTTTCATCATGACCGATCCGCACACGACCATTTACTCCCCGCA
GTCAATCGGATGGTTCTCTGAAGATGGCAACGAAGTCTGCGGCATTGGTGCCTTCTCGGTTCTTCACAAGAGCGTGGGACTACTCGGTCTAGCGGGTCTG
GACCGTATGCTCTCGTTCCGTATCGTCCACACGCTTAACAACCTGGTCAAGTTCTGGGGTTCAGCTGTGACGCCTTACTTCCCACTCCTGGATCAGCTTT
CTGCAGCGCTCGTACCAGAGTGGAAGCTACCCGAACACTCGACCAAGCTATACGATGCTGCGCTGAAAAAAGTGGAGAAGATCATGAGTAAGTTGCTGAA
GGCTGTGCTTATTATCGGTCAAGCAGCACTCATCCGACGACAAATTTCGAGTGAACTCTCGTTCTCGAGCCGTTTGGATGCTAATTTGTTGGCGACGACG
CTGGATACGCTAAACATTTCGCTGCTGAACGATATTCGCGCGCACTACCGTGACCCAAAGAACAAACCGTACCCTGGCAGCGATGGTAACCCCGTGCTGG
TTGAGCTGAACAAATACTTGGAGAATACCGGCGCCAACGATCCGTTCCAGAAGATCTACGTTACAGTCGCCGAGCCCATGGAAGGTCTAGCGGCCATGTT
CATGCTCTTCGTGGTCGCCTACATGCCGAAGCTTCAGTACGACCGCAACTTCGGGGCGCTCAGCCGCGTTGGAAAGAATCCCATCGATGGCGAGCCTCTG
CTGGTTGGTATCCTTACCATCTTTAAGCAGTTCCACCCGTCGTACACGGAAAAGTTCCTGGCTTACTTGGGCCAATTCGTGCGCACGAAGGTCAACGACA
TTTTCGCCGAGAAGGCTGATAAGAAGGGCAAATCTTCGTTGCCAACTGAGTTGCCTGTGGATGTGGTGAACACGCTGATCTTCATGCTTGAATTCGCTCG
CTGCGCCAAGATCAAGCGCAGCATTCTCGACGGCCACGTTCCTGCGTATGTTTTTGACGCTATTCAGCTCTAGTTTTCACCAATTCTTGCTGATAGCAAA
GCCGTGGGAAGCAGAGCAAAGCAAGCTGGACATAAAATCTAATGCACAATACAAGTAGATTTCCCAATCCACGTTGAAGTTGCCTGTCACTAACGATTAG
TGACATAATTTCGCACTTAACCGCGACAAAGCTAAGAATTCCTAGGGAGCCAGAAAACGAAGCAGGAACGCGCCAACATGAGCGAATTGGAAGCTGGCGG
CGGCTTCAAGGAGCCCTCGCGCGCCATCTTCGCGCAGAACGATCTGCGTCACTTCCTGGGCTCTCCGGTACGCGTTGCAGTGCCCATTAACGTGGTGCTC
TTCCCTACCTCTTGCCGTTGCTTTGTGTTTAAACAACCTGCTTCTTCGATATATCCACAGGCCCAACAGATGATCTTGGTATTTGTGAAGCACCTGAACG
AAAGCGTCAAGGGCAAGCGCATTTCCAGCGAGTATGAAGTCTCACCGGTGCGTCGGCAGCTGATCCAGGACGAGATGTGGAGCTGAGAGAACTAATCTTT
TGTATGTGTGTACTTGGGTATTTGCGGTGGCGTTTTCAGAATGTTCAGAAGGCCGTAGATCTAATAAACGAGATCAATTCATGGATCGACGATATCCCTC
CCATCCAGCAGCCTATGCGCTTCGGTAACAAGGCCTTCCGCACATTCTATGACCGAGTCGTTGAGGTGAGAGAGGCTCGAGCGCTGACGGCTGTGCCAGC
TCAAACTGACACTATTGTTTATTTGTGCTTGTGTATGGTGAGCAGAAAACACCAGCTATGCAGGAGGATATGCTGCCGGAGAATCTGCGTGGCGCTGTCA
CCGAGCTGGCTGCCTACCTCGACGACTCTTTCGGAAACCGTGTCCGGATCGACTACGGCACGGGTCATGAAACCAGCTTCATTGTGTGGATGTGTACGTG
TAATATGCAGTTAGTTGCCTATGGAGAGATTTCTGACTGTGTTTAATCTTTTTATTTTATTATTAACAGGTTGCCTGCACAAGCTGGGCTTCTTCAAGCA
GTCGGATTTCCCAGCGCTTGTATTGCAGTTGTTCACGTCTTATCTGGCGCTGATGCGTCGCCTACAAAAGCTGTATATGTTGGAACCGGCAGGCTCTCAC
GGTGTTTGGGGTCTGGATGACTATCACTGTCTCCCGTTCTACTTTGGTTCTGCACAGCTGATCGGACAGCACGAAATTATTCCCGAGAGCGTGCATGACG
ACGGTATCTTGGAGGCTAACCACGAGGAGTACTTGTATCTGGATGCTATCAAGTTTATTAAGGAAGTTAAGGCAGGTTCACCCTTTGCCGAGACATCGCC
TATGCTCAACGATATCAGTGCTCTACCATCGTGGGAGAAGACTAACGGAGGCATGCTCAAGCTGTACGAGGGTGAAGTACTGAAAAAACTACCAGTTATC
CAGCACCTACGCTTTGGCTCACTGTTTCCGTGCACATGGACACCAAGCCACCAAGCCGATGATGGCTCGACGTACATTCCAGTTAGCACGCATCCAGGTA
CGGGCGTTCGTGCTCCTAACTTTGATCTAGACGGTGTGTCAGCCAGAGCGCCGTGGGTTGCTGTAGAATCGCTTGCGGCCACTAAGGACACTACGATGTC
GGCCATGGGCCATTCCAAGGAGACTCTGAACAAGTAACCCCCTGCCAACGAAAGTGCACCGTGGCCTGGCAAGCGTGCCTGCATGCAGCTCATGCGCGAA
CGCTACGAACCGGGTGGGTACTGCCAATCAAAAAAGTGAAACGTGGTGTTCCCG