Description :
From Genome Similarity Track
Location :
Scaffold_7:379241- 384375
Sequence
5134 bases(100 bases per row)
ATCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACAACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGACCAGAT
TCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCCCGGACGCAGAGTGAAGATTTCCACTGCTGCTCCACCCCAT
CCCCGCGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGCTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGG
AAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATATGGCAATCTCGCAGATTTTGCTTA
TCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGG
AAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGA
GGTGGATCCGGATCCGGATCTAGGAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAGGTCAAGATCCGCTAACA
AAACAAGGGAAAGTGAACGCGAAACGGTATGTATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAA
AGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGGCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCT
CGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTAATGCACATCCTGATTTCTCGACAGCATCGAATACTATGAACACCG
GGAATGCATCTGCGAATACGGCCAACCATCTGTTGTCCTTCCCGATCCAATAACTTTGTCAATCTATTCCGCATCGCATTTGGCGCGTCTGATCATATTA
TTTTCTTCAATTTACTCTTGTCTCTTTTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCGAGCGAGAACATGGAT
CAGCAAGGTCAAGTCGGCCCTCATGAGAGATCAAGGGTCGGATTCCGAGAAGTGTCTGACCTTTGCGGATTTGCTAGCGGGGCCAGCCAGGAATTGGTAT
CGGCAGCTGGGTAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACT
ACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTGCATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATC
CAAGGTACTGCGGGAGCATGTGGATCATTTCATCGAGACGTTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTGCGACTTCCCGACGCAGACGAG
CTTGAGGAAGTGCTGCGGGTTGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCTGACGCCCACGG
CCCCAGCTCGACGTGTCCACCAAGTCACGGCACCCGACTCAGGAACTGAATCAGGACCCGACGGTTCGGACTACGATCCTGAAGATTACCGTCGAGTCTG
TCTCACTGCGTCCAACGATCGAGCGGCGAAGACCGGAGACAACTCTCGACCGGGGGATACCGTACTCGGGGACCGTGGGATGTACAGATCTCGAGATCTC
ATGGACGGGACAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGA
AAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGGTTCACGACGTCGGCAAGTGTCCAGTGGAAGAATTCTACAACCAGATCCG
CCAATGGATTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCG
AGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGATATCGCTAGATCCAGGTAGCAAGACCCTAGATCCACTCGATAATACATGTGATCTACATGA
GGTGTCAGTTGTCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTTCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGT
TACTGGCAGAAGCGTCAACATGGTCGATGGTTTATGTCTACCAAGGGTGAGGTCATTGCAGATTCCCCTAAGGTCTGTCAGGTCACTGAATCCCGTGAAT
CTGAGGATGTGGAATCCATGGATCTACTAGCCGGGGAGTCCCGTGGATACTGAAAGTACCATGCCCCAGGAAAGTGCTCAGACAAGCCAAGATAGGGGGC
AAAATCAACAATGAAAGAAGCAATCCTACTCATAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGTCTTTGCTCGTAAAGATTGGGTGCCAAGTAGA
TGGGAGTCGGATACAAGATTGTGCTGGGATTGGTGAAGGCGTGTACCGTACAAACGGGAGAACGCGAATCAATGTCACGTTGGCAGGTTGTTTGGTGTAC
TGGTTTGATATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATTCTCGGGATGGATTTCATATGTACCAGGTTGGATCTGGCGGATGGGACACTTTGTT
TCCCTGGCGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCTAAGATGATTTATCATAAGGGCGGATAAGACAACCTGGATCGAGCCCG
GAGAAACCTGGGAGCTGCCAGATCGGTTGAAGTGGGTAAAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACCGTAATGCAGGGACC
AGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTGCTGGACCATTATGAGGAGATCGGGCGATGATTGGCGAAGGATGGTATC
CCCAGGCGACCTGGATATATGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAATCTCTCGGGGAGG
TGGAGCTCCCGGCGGGGCCAACTAGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATTCTGCAGAGGGATCGTCGGATTGAGATCCAGGT
TGGATCCACAACGGGGGATAATCCCCAGAGTCGGCCCCTAGATAACGCAGGGTCGGTGGATAAAGGATCGCAGAGGGCTGAAGCCGGACCGCCAGATCCC
GCTGACCCACAAGTGGATCCAAGCTTTCCATTGGATAATGTGCCTGGATCCTTGTCGAGAGTGGCCACTCTAGCTAAACAGGAACCATCGTGGGTAAGTC
CACCAGAGGATCAAGTCGATCGAAAAGGTGGACTTCCCAATACCAGGATACCCGACCCCACGAAGACAGAATGGACGACGGTTGAAGGAGAGTCGCGGTG
CTTGGATCCAATGGTGAATCCGACAAAGACTGAAGATGAGCAAGGCTGCTACCGTGAAGGCGGGGATCTGCACGCCGAGGATCTTGGAGAAGGCATGGCG
GTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCCGGGGCGAACGAACCCCCTGAAGTGGATCGTCTGCGTC
AGAAGATCTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGTGAA
ACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGCTCCGAGAGAAACTATCAGATCTGATTAAGAGCCTGCTGCAAGCTAAGATCATCAGTTTCTCG
ACATCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGTTAGTTAGCGGCCTGACTCGATT
GATGGTGTATCCGATGCCTCTAATCAACGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGCGGTTTCTGGGTGGTT
ACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGA
TCTACCAACGACTGATCGATAACGCCCTCTATGG