Description :
From Genome Similarity Track
Location :
Scaffold_382:3791- 6255
Transcript NameFunction/comments
Phypl_g7669peptidyl-tRNA hydrolase, putative
Phypl_g7670calcineurin-like phosphoesterase, putative

Sequence
2464 bases(100 bases per row)
CGATaatggaggacgtggccTGGAAGTGTACGGCGGCCTTCGTGCTGGGTGTCGCGACGCACTACTTCGTGTCCTCGTGCCTGCTGAGCGACGGCGCCTC
GCCCGCCAAGGCCCCAAGCAGTAGTgacaacaacgacgaggacgccgcggAACCGCGCTCGGGCGCCTCGTCCCGGTCTTCCTCGGGGTCGTCGGACGAC
TGGGAGGGGGAGGACTCGACCAGTTGGGAGCCCCACAAGATGGTCATGTGCGTGCGCACGGACCTGAAGATGGGCAAGGGGAAGATCGCGGCCCAGTGCT
GCCACGCGACGCTGGGCGCGTACAAGCGCGCCGCCAAGCGGACGCCGGCCGCCGTCCGCGCCTGGGAGATGCTGGGCCAGGCCAAGGTCTGCCTCAAGGT
ggactcggaggaggagatgctCGCGCTGGCagagaaggcggcggagagcgGACTCGTCAACTACGTCGTGGTACGTTGGGTATGAGAGATGGGGAGGTGG
GGGGGGCGAGTTGCTGATGTTTTGGTGCTGTGCTGTTGACAGGTTGACGCCGGCCGGACGCAGATAGCGCCGGAGAGCAAGACGGTGCTGAGTATTGGCC
CGGCACCACTGAAGGCTatcgacgagatcacggGCCACCTCAAGCTCATGTGAGCAGGAGCTTGAATTAATAAGCAAGAGAGACGGTATGCTCAAGTGAG
TGTGGGTGGACCAGGGTGCTTTACATTCGTCTTTTCCTTCCTGTTTTGATGACAGGTGCAGGTTAAAGAGTGCTGCTAGAGCGTAGCAATGGTGTTGTAT
TGCGAGCGGTTTTTGAGGACACCAGCGCGTCGGAGAACGCAAACGGCCAGCGCAACACACGCCACTGCGACGACGGTTGCTAATGCTGTCCCTCCGATCG
TCACCAATACGTCTTTTGTTGCAAAAATGTTGACCGAGCCGCTGGAACcagaagaagccgctgcgaCCACGTCGGCAGGAGACACTGAGGTGTAATCGTT
GTCATCTACGCGGTCAGCAAGCATCGTttgggcagcgtcgacgcagGCCAGGAACTCGCCCTTCGTAGTCCACCACTTGAGCGTGCACAGCGTCTTGGCA
TGGCAGGTTGCGTCCTTGCAGGGTCGAGAATTGGGAGAACGGGCCTTCATGTTCCAGTAGTAATCCTCTAGCAAACTCACGTTCTGCTCAACACGGTGCA
CAAAGGCCGACAACTCGGTCAGAGACAACGACTTCAGACCATACGCCTCGCTCGCCTTAAACAGAAGCTTCCAGTCGAGCTGAGGCTCACTCTTCGCGAT
GTAAGACGCATACACGGTGTAGTCAAGCACCTCGTACGTGTCGGTATCGTAGTCCCAGACCATGAAAGAAGGATTGTTGCCGAAAAGCGGCGAGATCGCA
CCCGTGGTGTAcatcggcagcagctggaaaGCATCGTCCTCTCCTGATGGCCCATCAAGCGATGTCACGGGCACACGGAACTCGACACTGTGCACGTGAC
CGAAGAACTGCGCCTTGATCACATCGGCGTACTTTCCAACGGTGTTCTTGTACTTCACGATGTACTTCGTGTGCCACTGCGGGTTGCCTCCGTACGAGTC
CACAATCGGAGCAATGTGACCAGCGATGTACGCGAACTTCCCAACATCCTGCAACTCAGCAAGTGTCTTGTCCAACCAGCCGAACTGTCCGAAGGGATCC
GGCTGCTCCGACGTGTCTGGTAAATGACTCGGCTGCACGTaaacaacagcaacaacaaaaaatACTCGTCAGcatcagctcgtcctccatctAATAGCAA
CTGCAGTTCCGCCCTACCGAGTAGGGCACTGTATTCAGCGTGATTACATGCAGCTTGTCATCCAGTGCGTAGCTCAGGTATCCTCGTCGCTTCAGTTGAT
CCATGTTCGCAGCCGACAGCGAGTCCTCCCAGACCTCCGAGATGAGCTCAATGGACGGGTTCGACTCCTTCTCCGGGTCCGTCACCTCCATGTGGTAGTC
CGGGTCTGCCACCACCAGTAAAACAACCACAGCACTTAGCGtcccccctctctctctcatAGCGTAACACTATTTATCTCTCGTACTCCCGTCTGCGTTG
CCAATGATGGCCGTGGCCTCCAGCCTCCCGTCCTGCCTCTTTGGCGGATAATAATTCTCCATTGCGTGGACGTTTGTCTCCACGGCTTTTGCAAGGTATT
CGTCCGCCAAGATTCCGTGGGCTGCGTGGTCCCCCGTGTACAGGAAGAGCTCGGGGTCGGCCACCACGTGCTCCTTGGCGTGCACCAGCGCGGACTCGAG
CAGTGGCAAGGGCGCGTCTTGGAAGTAGCGGATGCGCGTGTCGTCCGCTGCGGAGAGCGACTCGGAGATGTTCAGGTGCACATCCGAGAAGTGCAGGATG
CGCCCCACAGACGCCGCGGACGTCGGTGCCATCAACAGCGCgagcaccgccagctccaacATTG