Description :
From Genome Similarity Track
Location :
Scaffold_3:379096- 383468
Transcript NameFunction/comments
Hyaar_Emoy2800593Avh152
Hyaar_Emoy2800594hypothetical protein
Hyaar_Emoy2800595coronin-like protein

Sequence
4372 bases(100 bases per row)
CACAGAGTAGCGCGAAGAATTCATACATGCCAAGAAAACGGTGCATGGCGATTGCCACATTCGTATTCTCCCACTTCGTGTCAACTTTCATGTGTCCTTC
AGACTATTTGTATATCGTTGAAAAAGGGGGTCGCGAAAGAACGACACAACCTTATTAGCCAGCGAGAGATCATCGTTCCGCCATATAGTCAGTTTGCGCG
TGAAAAGGTCAAAAGCGCACTTATAATTCTATGACCAGTCTGCAGACACCTCGGCCAGCAGGCTTGTGGCGGCGTTCTTTAAGCGCTCATCCTTTACGTC
TTTCACCTCCCACATCGCCCGCCAAGGCCACCTGTTCTTCAAAGTGAGAATTCGTCAATTCCGACAGTATATCAGAATCCGACATGCTATGGCCAGCCAG
CGCCGTAAACTCCCACGCAATTTCTTCGTGACGAAAAAGAGTGTCCAGAGTTGCTGAATCAAGTCCTCTCCAAGCTGCAACACTTTTATACCGACGACAC
AATCTGCCCTCCTCATCAGGACGGCGAGAGTCTCGTTCGCCAAAGTCCATCCAGGCCTTGACGTCATCTGGTCCGACCCCCTTCTAAACCAGTTTTTAAT
TTGCGCCGTCGGCAAATTGCCGGCCGTCACTACTACGTACGGATGGTCGCTTGCCATGAGTACACAGGCAAGATATCTATCACCGAAGACATGGGTCATG
CATGACCTTGACCATTGTCATGGCCGGGTCATGCTTGTCGATGCCCTCCACGAGTGCTTTCCACTCCGCGAAATTCGGTTCGCGAAAAAAATAAAATAGA
CTCAATTTGCAAATTGAATCCCTGCCTCGCTTCTGAGGCCTCATTGCTGAGGCCTAGACTGTGGAACTTGTCTTCAGCTGACTTTTGCACCTACGCGGCC
TCCAGTCTGGCTGCAACATTCCCCGCTTCTTCACCTCCGAGGTCCTTCATCGCGGCGATCCACGAAGCCACTGCTTCCTTAGTGTGGCGAGTCATCAATG
TCGACACCATCTCCAACTCCGAAATGTCCTTGTGAGCCAGCTCCAGGTAGCTCTGTGTGACTTTTCCATTCACAGCAAGACGGTTCCATGCTGCTGCGTT
TGGCCCACCCCAGACATCAACATACTGCAGTGGTTCCTTCCCGTGAACAACCATAGACAACTCCTCCGGAATCCAGTTCTTAACAACTCCGGCAAGCTTC
AGAGCACCTTCCACCACAAACTCAGGATCCCCAGTTCTCGTCTCGCCGTCGTCACGCATCGTTTCCACACCTGAAATTTAATCTTCAGGTTCGTTAGAAC
TCGGCGCCACAGGTTGGCCATCTGGGGTAGCTGCATCCATTGCCGCAATTAACGAGGCAGCAAGCAGCGGAAAGGCGGAATGGTGACGCATGGCAAGATC
AGTGGTAAATGGCACAATGAGCCACGAGGGTGAGAGCGACGGAGCCCATGACGCTTTTTTGTATATTGGTGAATCCGCATGACAGTGGATTTTGTCACAG
AAAACAGAGACAGATGTACGTTAACAGGTCTTTCTACCTCCAGCCAGCGTGCCCTTATTAGAACGAAGTATATTCTACAAAAAAGATCGACATGCGCCAT
ACGGATGCCAAACCACGGGCGAGGGGAATCCGTACTTCGAATTTTGCTTTAACGTACTGCAAACGCGTCAAACGTTTTACGGACAACTAATTAGCTTAAG
AGTTAAATTTTATCCGTAATATGCTATATATAGAAGTTCAGAGGTGCAGAGTTTGTAAAGCTTCCTCTGACTGCTTCTAGTGCTAAGCCCAAGCTGGAGG
CTGTGACACCAACTGTAAAGGATGCCGAATATATGGGGGAAAGTGTGTTTGGTCCAGGGCTGGCACCAAGTGGTTTTTTACAATCGGTTTTTATGTTTTT
TGTTAAGACCCGACAGCCTGCGATCTTCCAAAATCAGGTTTTATTAGGTTTTATTCCCCGATATATCGTGTGACTCACGCATGATCCGGACGGACGCCGA
TCCCTACAACTGCAAGGAAGCCAACAGACATAATAAATCATCAGTATTTAATCATGATTAGCACCCTCTAGCTGCACTTAATAGTATGTCGCAAACGTCG
TTTTCTTTAAGCCAGTTTGACGAGCATGTCGATAACTTCAACGACGACGTTCTCGACCTTTAGCAGCCAGACGCGCAGGTCGCCATGTTGGACTTCAGAG
TGGTCGTTAATGATGATACAGAAATGTAATTCCGGCGTCAGAACGGTAACGTGGTCGCTCTTCTAGCGCAGTCTGGAACTGGTTTACCGATGATGCGTCT
CCACTAACTGCCAAGAGTGCCGAATGCATGCACTAAAAGACTATGATTAATCACCATAAGAAGAGCAAAAGTACCAAGCTACACCTCAACTCTCGTGATT
TATCGGAGTGGGACTGCCTAGTGTTAACCGCTTACAGCTCGAGGACGTTCTGTAGAATTTTCCTGTAAACGACGAGCCTCGCGACTCATTCGATGAAACA
CGAGCGCAGACCATTGGAATTCAGTAGAACGAGTTCGTGATTGCGGCTACATTCACTCTGGCTAAGGAACTGCCTCAACCCAAAACGAGGGGACGGACTG
ACGTTCATTCGAAGGAACTTGACGACCATCTACGACTACATGCACGACGGTGACGATGATTCCGGCAGAGAATCTTCCTAGTAGGCACCCCCTCATCGAG
CCAAATAAAACCATGGTTTTTGCCTGAAAGCGGGTTTTAATGTATTAAACCAAAAATCCGATTGCCTCGCCAAAACTAATCGGGTTTTTTTCAGCCCTGA
TTTGATCGTCCGAAAGCGATTGAGCCTGGTTGGGGATCGCTAAAGACCAGTGCCGTAACCGCAATTAGTGGTTGGAAAATGTCAGGTTTGGCCAGGCTTT
GTTATCATCGGCGTCGTTGAGTGCACCATCAAAGATTGCGTCTGATGCCACGATAGGCTGGGGGCCAAACATGAAAACGTGGAACGAGCCAGAGCACAAG
ACTGAGACGGCCCCTGTTCGACAAAACACAACGGAGTCATGACACCACTTGGAATGCTACTGCTACAGCACCAGAGTCGGCAAATTTTCCATGGTAGTTC
ATACACCACCCTGCGATTTCACGTGTTACCACGACGGATGCATTCGAAGCTTTAATAACAAAGTCAGACGCGTCTCACCCCATAGATGTTGCTGCTACGA
CGCCCGACGTGCTAACGATGAGAGAAGATCCAACAACAATCGTAGATTGGTCAAGCTGTCGGACAAAGCGCGACGTATGGGTGCCAAGTATGGGCACAAG
CTGATGTACGTGCAAGGCAAGGAAGAACCACGCAACGACGTGATTTACTTTGGTGATAAGCGTGCAGCGTTCTCCACTCAAGCGTTACGTGCGATTGCTG
CAAACCCGACTTATTGGGCAGTGCCCGTTGTTGGTGCAGGTGGGCCCGTACTGGTAGAAAAGCTTGGTGCTACTGGAAAGGCACAGCATGGTGCTGTGTT
AGTGCTTAAGGGACAGAAGACAGCAAGCTTGCGACCGGGCCATCTAACTCCACCATTCAGCTTTGAATTCTTCCGTGAACTAAAGCAAACGCATCCGACG
CTCCAAGAGACCCCTCTCTGACTATCAGGGCACACAATGGGCGTGCGAACACTTCAGTTCAACCCGACAGCAGCGGGCATCCTATGCTTAATAAGCTATG
ATCTCTCGTTGCGCTTTGGGATGTAAGAACAGGGCAAAAGATTACGTCTGGAACACAAGCTGGATGACATCGCGTAGAATATGGCTATTAGCCACAGCAA
GCCGCTAAAGCTACACCATATGTTTCATATAAAGCTATTTTAAGGGTGACAAACAGGGAACTACAACAAGGTAAAGGAAGCTCCACAAACTCTGCACCTC
TGAACTTCTATATATATATAGCATATTACGGATAACATTTAACTTTTAAGCTAATTAGCTGTTGGTAAAAACGTTTGACGCGTTTGCAGTACGTTATAGC
AAAATTCAAAGTACGGATTAGCCTCGCCCCCAAACCACGGCTTTTGTCTTACCTCGCATTTGCTTCTGACATTTCCATAAAATTGACTAGGATCAGACCA
AGGCTAGAAAAAAACCGACTTCATTTGGTGGGGCAATTGGATTTTTATTTAAAACAATAAACCCTATGTCAAGCTAAATAAAACATAGTTTTATTCGGTT
CGATGAGCGGCCGACTTTTTATTGGCCCCACCTCTCGTATTTCGTCTGTATCAACCAGGACGTTCATCATCATTCATGCCGTTAATAAACAAGCGGAAAT
TTGCTTAAGAGTTAAGATGTACCTAGGCGATATCAATCTTCTGATGGTGATTCATCAGAGTCTTGCAGTGCA