Description :
From Genome Similarity Track
Location :
Scaffold_997:379- 2414
Transcript NameFunction/comments
Phyta_totarag11692hypothetical protein

Sequence
2035 bases(100 bases per row)
GACATGGAATAGTCGAATACTCAAAAGTGTATCTTGGTTACCTACGAAACTCTTCGGTTCCAAAATTTCTCTGTAACAATGGTTTTATTATGTAATCTTC
CCTCTTCATCAATAGCAACCGAGTCTACTGCAATATTGACCACCTTTCTCGAGGTCACTCTGGTCAGCACCACGTACAATTGTCCGTGTGCAAACAGAGT
TTCATTACTCGCGTGGTACTATCATTGGTAGCTTCGCTGCACAGCTCAAGTTAGGATGCGATTCGTAGCGCTGCATTTGGTCTTCTTATCGCAATCCTGG
TTACGTGGCAGGCCCAGTATGGTAGCGGGTTGGTCAGTGTCGCCACACATGTGCCAAGTGAAATTATCTAGTAGTATAGCACAAGGCGCTTGTCTAAGTT
TGAGCAAAATTTGGCATTATAGTTCACTCGAGTCGTGTGAGTTGTTGCTAAGCCCAAGGTCGGCATGGGTTTAGTACTGAACATGCGTACATATAGCACT
ACAATTCGACAGGGGAGGGTCCGACGCCAAGCAAGCCGTAGACCATAGCTTACTCATGCGTCCGTGTTGTATGTAGCTACCGACGAATATCTATCAATGG
TAACCCAGTAACATTTACGTATAACACTGGAGCAGCTAGTACAGCGAAAAGCCCCACGATCCACCTATGAACCAATCGCGCTGCATGGATATTGCGTGCA
GGATACACACCAACAGCTTGTACCGCGACACCCAGCTGTGTTTTGTGACAGGAGGCACCGCGTCAATCTCTGTTATAGCGTGCATATTGCGCTTGGTGCT
CCGTGTACGCAACACGCAGCGTGTACACCTTATGGCTTCGCGTGCGCATTCGTGGTGCGCAAATACAGTGTCAAGCGATATAGTCGTGTACACATGCGCT
TGTGTCGTGGTCGTCCCTCATACTCATCGGAGGAGCACCGTGCCAGCGTGCTGTGAACCTTTAGCAGTTGACTTGCAACCATCATGTTTCAGTGCATAGC
ACGCTCTCGTTTGTGCCAGCATACGTGACACCATACGCATGTAGTTGCAATATGGCACGGATACGCAGTGCAGGATTCGTAGCTGGTTGGAACCCTCTGT
CCTCAGTGCTGCTTAGCCCAGGTTGTCAGTGTGCCTGCTCTACATTCTCACACAATATTTCTCAGGCACTATATTCACGATCCCACCACGATAGAGCTGC
GCACATCAAGAACATAGCCCTACCTATAGGTTCGCGCGTGCGTACATaatgtcaaaatgcaaacatTTGCTGTCAACCGTTCTACATTAACCCTATCGCG
GTGGAAGGGCGAATGATGCGCCCGTTAAGCTTATTCCTCGATCTCACCTACCATGTTTTGTTACCACCAATCATAATGTTCATTTGAAAGGCTGGGTGTA
ATTTTGGGCGAGATGCGGTTATTTACTGCGCCGAAGCCATAATCCGTGACCATAAAACTGTTTTTGAATCCAGAGCGTGTACCGAAACGGGCCTACACTG
CTTTCTATCTGCCTTTCCTGCTAGCCGTTCTTACGAATCAAAATCTAAGACGCATGCAGTTCTATCGATACGCCCGttactggagcagcaatgAGAACAG
ACTGCAAAGACTAGGAAGACAGAAAGCTAGTGCAGATAGCGTTCTAGTTCGAGAGCGAGCGCCTGCGCATCATGTGAGACTATTTAGCGCGGCGAATGCA
ATCTCAGCGCActgcgctccagctccgattGAGAATGGCCTGCCTCAAGAGAGCGTACGGCAGGTTCATCGGCGATTTCTCTCCTTGTTTCTTCGTAGGC
TTCTCGCATTGCCGTCTATTAACAGCATTGGGGCCTCCACCCCCTCCTCCTATCATTTCATCGGCCCAACATCCGAATACCTTATCATTAGCAAGTGAAC
AACCCGGAGAACAATGGGGACGCGGAGGCCGAGGTGGACGTGGCAcccgtgctgctgaacgTGCGGATGGCGAGGCTGCGGTGACAGGTACAGTGGTGCT
AGCGTCCTCATGATGCAGGCTAGGCAGACTGACTA