Description :
From Genome Similarity Track
Location :
Scaffold_1824:379- 2253
Sequence
1874 bases(100 bases per row)
TCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTACCTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCT
TTTGGCGATACTTGCCGGATCCGACCGCCGCCTTATTCTGGCGGTGTTTCGCGCGATTTACCGCCCGCAGCACTTCCTCAAGCGCGTCTGCGTCGGGAAC
ACGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACACGTTCCCGTAGTACCTTGGATCCCCCATCCTTGATC
TTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGCAGGTATTCTAGCGGAGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCG
ACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCCGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAATTCCTGGCTGG
CCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCCTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGG
TCCTCATCTTGATCCTTGCCCGTGAGCTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCTCCTGCCCCGGCTGCGGCTG
TTGCTACCACCGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCG
TGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCCCGGGCGCTCTCATACCCTGTTCGGCCAGGGAACGACTCATCGCAGCTTCGAAGTGTCGCTTGAAG
AGACTTCGGATTTTGATCTTTGCTTCTATGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAGCGCTCACATGGCCGATGGTTTGAGCCTACCA
AGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCG
TGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCGAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGT
GCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGACTGTGTTGGGATTGGTGAAGGCGTGT
ACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATCTGGGTTGGAGATCTCGCTGGTCAAGACGCCAT
CCTCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTGGCGGATGGTACACTTTGTTTTCCTGACGAGATGCGGATCCAGCTCAGCGGACGG
CGACCGTTGTATGGAGCGAAGATGAGGGTCATAAGGGCGGATAAGACGACCTGGATCGAGCCCGGAGAAACCTGGGAACTGCCAGATCGGTTGAGGTGGG
TGGAACATGAGAAACTGTGGGTTACTCGGGGCGAGAAATGGGTACCTACCGTAATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAG
CGATAAGAGACTATTACTGGACCATTGTGAGGAGATCGGGCGATGGTTAGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGC
CGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCCCTCGGAGAGGTGGCGCTCCC