Description :
From Genome Similarity Track
Location :
Scaffold_1337:379- 2178
Sequence
1799 bases(100 bases per row)
ATCGATGTGGTAAATCGACGCCCGGTTCCACAGCTGAGAGTCTAGCAATGGTCACTTGACGATTGTACGCGTGGAAGCTTGCCGCCTCGTACTAGGTGAG
CGCGATGGTGACACGGGATAACCGTCTCACAGCCCAAAGTTATGAACAGCGTATTATTCAGCTGGGTGGTGATCCTACTACATTCAGGATATGTATATAG
TATTTTGGATGTAGACGGAATTTCAGGGATAGCGGTGACAGCGAATAGTGCGCATAATGTAGACATCTCCTGCATTTGTTCGTAGTTCGAAGAACTATCG
TAGGGGGGTCTGCCAAAGGCGGCGCGTTTTGATCGTGCGACCTATGTGCGACGTTCGGGAGTCATTCACGCGACGTTTGGGCGACATCGGACGGGGATGT
TGCGGGCGGTGGGTCACTTGCAGAACGACCGCAGAGGATCGAGCGCTCGACAGCGCACACGCTCCGCAATCGCCGTCAGGGACGGCGACAGCCGTTTTAG
CGCGAGTCTTGAGTGCTGCAGCTAGTCAAATGCATTCATTGAGCGAGTGACGAAGCTTCACGAGTAAAGTCCAGAGGTGCGTGTGCAATGTGCATGCACT
TGCAAGGTGGTCGCTAACGTGTTGATTATCGATGTTAGGTACTTTCAAAGCATTCTGGTTCATTGTGTTTCGCTGGGAGTTGGGTGGCTGTAATGGGCCT
ACTTTGGCTCACTACTTTAGCACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAACTTAGAATTAATTATACTCGGGCCTCCGAGTATAGAT
TAATCTAAATAAACGATCCAAGTAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCGAAGAT
AGGAATCTGCCAACGGCTGGTTGGCAGAAATCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCAA
TGGACCACTCGTCGAGGTGGTCGTAAATGTATGTAGCCATTGGTGTACCTTACACCAAGGTCGAGGAAGTGTTCAAAACCTCTAACAGACATCGCATCTG
TTAGAGTAACAAGTGACTGTAGCCACTTGTGCGTGTAACCCCGTTACACCATCCCCCCGTCAAGGTTAGACGTGCCGGTCTCGGCACGTCAACCACCATT
GACCGTTTGGTCAATGCGTGACGTTGAAGAGAGCGCGCTCGTGATGGAACGAGCGCGTCGAAGTTAAAGTCCGCTGGCGCAGCAGCGGAGAACTTCTCTG
CTGCTGAGTAGCATGCGCGGCAACGTGCGAAGTGCGTCGCTGCCGCGGGGGCAGGACCTACGTCTGCCCTCGAAGTGTCTTCGGGCGCTACTGTTAACAG
CAGCGCTCGCATTACGTTCCAGTATGTAGCGCATGGTGGGCTTCGTATGCCCTCACCATGTCCGGGACGCCTTCGAGCAAGACGTTCCGCGGCTCCCATG
TATCTTGGTTGGGAGGGAATCCTCTCCAACGGATACGAAAACGAACCGGTTGCCTGTTCGTTCTCGGGATACCGCGANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN