Description :
From Genome Similarity Track
Location :
Scaffold_30:378955- 380018
Sequence
1063 bases(100 bases per row)
TAGCTCAACAAAAATGCCGATAATAATAATAATCCTGGCAATGCAAACGGCATGTTTACACCACGCCATGTACGTAGGTGTCCTTAGCTTACGTGCCTGT
ATGATGACGACCGTAAGATCAATGTCATTCTTATCGAAAGCGGTGGGAGGTATAATAGCATGAATTACGTTTACAGTCTACTGACAGCCTTACACCGCGT
ATGTCGGACTACTTCTTGATTCGAGTAAAGCTGCAGGACGACACGTCTGTAGACTTCGGAAATACCAGTCCACGGGATTCGGAGTCCGGAATTTATTTGT
CTTTTGTATTAATTTTTGTATGGCTGCCATACAGGAATCGGTGAACGGCTTTGCCAATCTACAACTGCATGACATGTAGAACATGTTGGCCCGGTCGCCC
ACTCGCAGATCCATGTCTAGATTTGTATCGTTGCGTTGTGTAGTCATCAACGAAAGCGATCGCTTTGAGCCACCGTATTGCACCTTTGGTTGGGATTACA
CACCAAGCCACACGACAAGGCACGAAAACCATAGAGAGCTGATATCGTCTCATAATTCACAGGCACAGCATCGAAAAAGCCACCCTTCCCGTCGGCCGAG
AATGTTTAGATGTACCTATCGTGACTTATCAAAAGCCCGTTCTCAAGATTAGGACATGCTTGCAGATCTCGATTTGTCTCCGCCGTCAACAATCAGGTCT
CCTGAGACGCGAGCAGGACAACGAGGTACAGACTGTACTGTGGTACAGTAAACGCCTGGGGGCAGGACACCAGCCTATCCACGTTCTGAGCAGCTCCGCC
GCAAATTGTGCAGCTCAAAAGCAAATGAATCACAGTAGCAAACATCTATTACATATTAACTTCACACGATTTTAGGTGGCGAAGCATCAGGAATAAGAGG
CCCCGCCGCTGCACTAACATGGTTGAAAAGATAGACTGGTAATCGTGTACGATTACGCTGCTTTGCATTTATGCAGATTTCGTTCCTGTCAGGAAGGAAG
TTCCTGTGCCAGGAGCATTGGTGAATTACCAACATGTACTTGTACCTGTACGCAGCTTCGTCC