Description :
From Genome Similarity Track
Location :
Scaffold_57:37893- 39308
Transcript NameFunction/comments
Phyca_LT1534125089protein kinase, putative

Sequence
1415 bases(100 bases per row)
tttaattcatagaacgatgcgtaactgcggactggagaaattcgggtttgactttttccaaggccttaaaactgtgcaatatctgtacgtgatgctgtat
ctatcaagaatgggccttaaacttactcgatgacgttgtatgcagtgatttatccggaaacaacctcgctaaaccgtacgccggcaataccatcagcaag
acttgtactacacagttctgcgctgtccaagttttgtacgaacttttggatctgcatttatagtattgggaactaatgctttgttccataggaatctcac
tggaaatcagttgactacttttcctgatgttgttttcaatctcgatgatctcagcgaattgtaagatgctcccgtccttaagtaaatgaaactaactgtt
tatttgtacagatacattcgtgacaacaacatcacagatttcaacatcagcgctgcagtatttaacgatatctcatctttacgagcttacgaatcggatc
aaccagacgagtcgactacctgtacagacggaagctggcagaacgctcacggcgtcactttttgcgtacttaatgattccgatgtgtctgatggtacgat
cttgcttcttctttatttttttgaagtattcattatttgttttacactattcacagaaccatcaagtgctaccagtacattggtttacattgcaatcgca
gcggggagtgtcatgctcgtgttatttgtcatttttgtgtggatgaagtgctatccatcgcctctggatcgctcatcctcgtcctcgaagcttgactcaa
ccagagcgtctcacttggacgaaacgagacaagaagttgattcggtcctgctcaatgatcctgtggtggtgactaatcggatcgagtacagacaactgaa
aataggaaaatgcatcagcaaaggtggctttggcttggttttcactggcgaatacagaggacgtcgagttgccatcaagaaaatccgtcctgaccgcagc
ggagacgtatcggatattgagatttttctcaaagaaattattctcatggctgtgctttaccacccgaggatcgtggagtttatcggtgtggcatgggata
ctttacgacatctctcagcagtgacggagttcatggtcaacggagatcttcgacacgttctgtacacattcaaggaacgcggctctccattggcatggcg
gacacacaaagctcccatcgctttacacatagcagaagctcttacgtacttacactccctgcatcctccagtgatccaccgagacctcaagtcgaaaaat
gtactgctgaacatgcacttggaggcgaaactcagcgatttcggcatttctcggatacgttacgccatcgaaacgcatatgactgcaggggttggtactt
cgttctggatcgcac