Description :
From Genome Similarity Track
Location :
Scaffold_48:378906- 386446
Sequence
7540 bases(100 bases per row)
ACTTCCTCTAGTGCAAGGTGCTGTGTGACCCCGTTATCCTTGATAGCACTCGTAATCAATCCACGCCAAAGCGGGTCGACTACCTGAACCTCTCTAAGAT
TTGTTGCCTTGGATATGAACAACATTTCCCATCCGAACGGCTCACAGTTCGAGTTGGTTCAGAAGATGGCAGGTATCTTCGAGATGGAGGCCCTGCAGAG
CCTGGTGGCGTCAACACCGGCCGCGCAGCTCGAGCACGTCAATGTGTTTGACGCTTACGAGCAGGGTCTCATCGCGCATGTGCGGGAGAACCTGCAGGCT
CCGGCGGTGGAAGCGAATCCATCTCACCCGAAGCCAATTCGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAGCCTTCACTTCTGGGTCCGAG
AAGTAGAGCTCGCTATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCCTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGGGTTGGGTGTA
CACATCCCCTGGATGTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCTGCGTTCCTCCCGGCGAACTACGAGTTATGCCAACGCTCGCGCTTCCT
CTCGTGCAAGCAAGGGAGGCGTGAGCTGCACGAGTACTTGCAAGAGATACGGGAACTCACGGCGTCCCTAGTGGGAAACCCACTCAGCAAACACATCAAG
ATGACAGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCGCGCACTCAGCTGTTCCGGGTGCAGTCAAACACCCTTGAAGAGGCGATTCAAGTGGCTCTTC
GGGAAGAGTATAGCCATCGCCAGGCGCGTACGCCGGCCTCGCATGGCCTGGGAGTTCCTTGTCGACTCCCGGTCGAACGAGCCCCAACGGACCAGTTCCC
ATTGGAACTCGGCTCCACCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAAAGACTCCGCAGA
CGATCTTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCAGGATCTCGGGGGCAGGGGAACGCCGGAAACCAGTAGGGGCGGGGCGCC
CTACTGGGGAAGAACTAAGTCTTCTTGATGGGTGCGCGGGTAGCGCATACCACGGGTACTTAGCCCCTGAGAGTATTCGCACCCTCGAATCGGTGAAGAG
CAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTCAGAATCTAGATCGATTCTGGGGCATCGAGGAATTTCGCACGCCGC
CAGACAGTTGCTCGTAATAGCAACAAGTTGTCCGATGTTTTGAGAGAAAGCAAGGGCAACGGGACAGTATCAGAGCGACCGGCTGACGGGAAGGTCGTCA
CTGTCCCCAACGTCCAAGTGGATCTGGATGTCAAGCTTGAAGAATTTGACAGCCTCGAAGAGTTCACTGTTCTCGACATGGATCCATACGATATGATCCT
GGGCATGCCCTGGCTGAGAAGCACGAGCCCTGGATCGGCTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGCCCGACAGAGCATTGGTGAGTC
ATGTTCCCACTTCTGTCGGAACTCAGGGCGCTCGCAAGGGTTGTCGGGGGACCAAAGCGTCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTC
CAAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGGCTCTGGCCAAGTGGGTAACTTGGGTCCACAAGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCT
ATCACGAACTTTGACGATAGCGTGTTCCGGGTGGGTAACAGAGTTCCACACACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGAATACGCTTCCT
GTGTGGGTAACATAGTGCCACACGCGATCGCCCAGACCTTAACTGAAGAGGAAGGTGTTGAGCACGCTTCCTGTGTGGGTACCACAGTATCACACGAGGC
CACGAGTGCCTCGGATGTCGGAGCGCCGACATCCCCAGACGTGGGTAGCAAAACTCCACGTCACGGTCGCCGTCGACGACGACGTCGCTTCAAGCGACTC
GGAGTCCAGTGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCGCATCTTCGATGGCGAGACCGGCTTACTCGTCAAGGCATCAGGTGTCCAC
TTGGAGCCGTTGCCAGAGGTTGCAGAGATACCGAACCTCGAAGAAATGACGGCCGAGTCTTTCCTGGCCAACCTCAAGGCTGGGGAGATTGCCGAGATGG
TGCTCATTAGACCAGATGCCACTCGGGAGAAGTTGAACTACTCCTCTGTCTTGGACGAGGACGTCCTAGAAGGTTTGAGCAAGCAGCGTCAGACGCGCTT
GGGCTCTGAGTATCTTAAGGACCCCCAGGAATCCAATGAAACAATACGTAGCGGAGTATGCGGACGTGGTGAGCAAACATCCACCGACCCAACTCCCACC
GGATCGAGGCGTACGGCATGAGATTGATCTCGTGCCTAACACAAAGTATTGTGTCACGAGGTAATGGCTTGATGCCTTCTTCGCTGCGAAAGCGAAGGCA
TGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGATGCCAGCTTTCTGCGTTCGGAACCCGAACGGAAAGTGCCGTCTAGTTCATGCTTATAACAAGCTGA
ACAACGCGATGGTGCCGGCCCAAACACCAATCCCACGAAAGGACGTGTTGTTAAACAACATGGCAGGAAGCGTACAGTAAAGTGCGCTGGATTTGGTAGA
CGGATACTACCAGATCTTGATGCGTGAGAGCGACATCCCACTCACCGCGGTGGGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGC
TTGTCTAACACCCCGGCGACATTCAATAGCCTCGTGACGCAATTGTTCAGGCCACTGCACGCCTTCGTACAGACGTACTTCGACGACATATTCGTCCATA
GCCGTGCCGAGGGACGCAAGACGGCCATGGAGGTGCATCTGGGCACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAGCAGGCTTTACGTCAACATCGAC
AAGTGCGTCTTCGCGTCATCAGAGATTAAGGTTCTCGGTTGCTTCGTAAGAAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAGGGACATAGCAGCAT
GGCCAACGCCCCGATTCCAGAAGGATCTTCGAAAAAGGTTGGGCTTGACTAACTATCTTCACAAGTACAGTGCAGGGTACGGGGGCCTCGCTAAGCCCTT
GTCGGGCCTCCTTCAGAAGGACGTCGACTGGCTCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGCCTCCCAGAGGCTCCTGTCCTG
GCCATGCCGGACGAGACGAAGACGTTTAGCGTCGTCTGCGATGCGTCCAATTACGTCATCGGGTGTGCACTGCTGCAGGTCAACACGGCTGGACATGAAC
GAGTCATCTCGTTCCAGTTCAGGCAGGTCAAAGCCGCCAAACGGCACTACCCTGTCCACGACAAGGAGCCCCTGGCAATGCTATATGCCCTTGTGAAGTT
TCGTGTTCACCTTCGGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCATCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCG
AGGTGGCTGTTCTTCTTCGCGGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAACTCAACGTGATTGCGGACGCCCTCAATCGGCGTCCTGACTACA
AGTTGGCCCACATCACACGGGTGACAACGGATCTATATGAGCGGATATGCATGGCGTATCGAGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTCAC
GGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACAGGGTGGAA
CCCTATGAACCTCCACGGATGGCCGTACCCAACGACGAGGATCTGAAGCTTGATATCCTCGCGGAGGCGCACAATGCGCCCTCCAGCCGCCACTTGGGTC
GCGATAAGACCTTTCGGTCGGTCTCTCAGGCCTACAGGTGGGCCCACATGTATAAGTGGGTGGCACGATACGTGAAGACATTTGAAGCATGTCAGCGGGT
CAAACCCGCAGGGCACTCTTCGGCTCCACTACAAAGCCTGCCCGTACCGGCTGACTGTTGGAAGTTGATGATTCTTGACTTCATATTTGGGCTTCCCGCC
GACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGCCTGAGCAAGATGTACCATCTTGCTCCGGTTCCCGTCACTGTTACGGGCGGCAAACCGG
AAGGTTGCTCGTCGATAGGGTGTTCGCTATCACAGTCTCCCGGAGACGATTGGCTCGGACCGAGACCCGCGGTTCACGACTGCATTTTGAGCAACGCTGT
TTCCTTTACTTGGAACTCGTCTGCAGATGCTCACTGCGGATCATCCGCAGACAGACGGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGAACACTCTGC
GCAGTGTGTGCGCAGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGCGTTTGCGCTCAGCAAACGCGGTGCACGCGTCCACGGGGCTCACGC
CGTTCTACTTGAACAGCTCCCGTCACCCCAGAGTGCCTCTCACGCTTCGAGGAGACACTGACTCCTCCATGCTAAGTGAGGGAGAGGCTCGGAAAGCCCT
TCCCCCCAACCCTTGGGTGTGAGACCAGTTTCGCAGCGGAAACAAGTGGAATCCGTTTTGGATACCAAGCTGAGCATTATCAGCAGGGTCCGCGATGCAA
TAGCGGCGGCCCAGAATAGACAAAAGGAGTACTCCGACAAACATGGAAGAGGAAACTGAAGTGTATTTAAAGTGGAAGAGTTAGTGTTACTAGCCACGAG
GAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTAC
ACCATCGCCCTCCCTAAGTCAATGACGGCGCACCCGACGTTCTATTTTGGACGCCTTAAGCGGTACTTTGATCCGCAGTGGTTGCGGGCTCGCAGACCCA
CCTTGGCCCAGCTCCTCGAAGCGAGAGCCGACCACAGACGTCGACGAAGGCTTCGGAGCAGGCACCCAAGCCTTGGTCTGAACGGCAAGGTTGCGGTCAA
GACTGTACGCTGGAGGGGCTCCGTACGAACGGACCCCGGAGCCATACGCCGAGTACGTTGAGTACGCCGGGTACGCACCATACGCGTACGTCGGGTAGTG
CGTCGAAGGCGGCCCCGGACGTGGCAACAGACGATCCGTCGGATCATGCGGAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGAT
GCAGGCTCGCGAACTCACGCTACAACAGGTCCAGGCGGGCCGCAAGACGAGCGAGATCGCCCTGATCCCCGGTCTGGGCGGGAGCATCACCGCCAGTCCT
AAGGCCAAGTGCAATCTCAAGCACGAGGACGCGTTGACGAAGGCGGTCAACCTAGGGTCCTACGTCGGACCAACAGGAGAAGCGCTCGGTCAAGAGTAGC
GTCCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGACACCTCTGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGAATCCTCCAGG
AGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACACCGAGAACTCGTGGGAGCCGATTGAACGACTCCTGATTGACTG
CCCGAAAGGTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTTCCCGAACGGGGTACGGACACTCCTTACCCGCGCT
CATCGTGAGCGCTAGAAGCCGCACGCTTCAGGGTGTCCCTTGGCAGCATGCGCTTGCTGGAAAATTGAACACGAAGATCACGGTGGTCCAGGATGCGGGA
CAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTGAGAGACTCCACCCAAGCCCAGAACATGTCCCCACGAGAACGCCAGGTGGGG
CATTTCTCGGGCAGAACCCAGATGTACCCCCAAAGAGGATAGAGACCACCCCGGTTCTCGGGCTTCTTACGACACGTAGTGAAGGCGTTAAGAGGGATGC
GTGTGGCGCGAGAAGCGCGCACCGAGCCGCCTCCAAGTTGTCAACAAACAACTGTTCCTTCTGGGCAAGAATACGTTCGTAAATGCCCCTAGAGGTGTGG
CCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCCAGGAAGAGGTCAGCCCCAGAGCTCTCCTTGGAAGGCCAATACCCTCTTGAGTTGATGGCAGCTC
CCTGGCTGACGGGTGCCACCACCGAGCCCCCACGCGAACGCTGGGCAGCTTGTAAGTTCTCCTGCTTCTGGTCGAGGTCATTAGTGATCTCCCGGGGCTC
CAAAATAGCACCCTCCTCCTCATCCTATTTCTTCTCCTTCTCATCCTCTTCACCCGAGGAGTCGAAGAGGCCCCGATGGGGGTACCGAGTCTCCTTATCC
TCGCGGAGTGGAGACTTCGAAGCCATACGCTTCTTAGAGGGCTTGGCGCCTTCGGCTTTCGCGGCCTTAGCACGAGCAAGTTCCTCGTCAAGGGAGAGAC
GGTTGCCAGGCTTACCCTCCTCGTCGACACCAGCTTTGGGAGTGCCCTTAGCCTTGACGGCCGTTATCTCAGAGCGCACCGACGTCCTGGGACTTTGATC
ACCGTGATCACTAGCGAGCGACAGCACGCTGTCGTCTTTGTGCTCGCTGGGCACTGGGATGTGCCCTCCCGTAGAGCCCACAGGAGCATCGTGCGTGCAT
CCAGACTCGGCTTCGTCCTCACTGCTGAGTCGAACTGACGTTCAGCGAACCGAGGGTTCGGACGGTTGTCTGGGGAGGCCGAGGGCGACGGACTGCGGCG
CTTGCTCGTTCTCTTGGCCACAGCCGCGTCACCCGTTGAGCCGATCTCTTCGGAGGCCACCTTAGTAGCCTCCTGGAGTGCCAAGCTTTTGCCGTGAGAA
TTAGTGCTCTTGGCTTGCGCCTTTCCGGCAGCAGCCCTGGAGCGTGTCTTCGCACCGCTCTTCGCAGTGCCACGAGTCATGACAAACAGTCGAAGCGGAG
ACCAAGAAGAGGAGCGCACAGACTGCTGCTCGAGGCTTTAACTGTGAAGTGAGCCTCAGCCGCGCTCGCGCTGCCAAGTCGATGTTTTTCGACTTTGAGA
ATGAATAAAATTTTGTGACGTACACTTCTTCATTCTGATTGGTCGGTAAACCGAGCCTAAGTGGTAACGGGGTACGTAGCCCTAAGTGTACCCCTAGTTA
CATGAAGTGTGACACGTCATACTTCGGGATGTTTGGTACA