Description :
From Genome Similarity Track
Location :
Scaffold_525:3789- 10417
Transcript NameFunction/comments
Phyag_g6380hypothetical protein
Phyag_g6381hypothetical protein PHYSODRAFT_327098
Phyag_g6382histone acetyltransferase, putative

Sequence
6628 bases(100 bases per row)
GGCTCGGCAGGCCACTGGTTGGCTGGACGAATGActggtcgctgctggcgtcgacTTTTGACTACCTTCAGGTGACCTTCACGCGACATGAACAAGTTGA
CTACCAAAAACGAGGGTAGTCAGTAAAAAAGCGACTCGGTGCAAAATTGAAGTTGCCCTTTTCCGCTGGTCAACAAGTAATCACGGCTCCCGCGCTTGTT
TAgctccctcctcctcctcgacgtcTCTCTGGTCCTTGGTTGCGAGCAATTGTAGCGATGCTTCTTTCAGGTTCAGCAGTTGCAGTAGTTTATCTCTTGC
GAGCTTGACGTCTCCCGAGCTCTCAAACCGGTAACTGACCTCCTTCACCACGTAAACCTGTAGCTCCTCCGTCAGGTTCAGCAATTTTTTAGCGTGGGGC
TCGAACCCTCCGTCCTCTTCGTGCAAATCCATCCAACTGAACACCTTCACCAGCGACCAGCAtgctgcagacggagacgcagcgaGGAACTTccgcgcct
tcttgccgccaaACTTTCGGTTCGAAACCACCTTATCGTGCCAGAATCGAGCGCCGTCAATACCCTCCATCTCGATCTTCAACGATGCAACTGCAGTGCT
GTTACCCTCTGCGTTTACTCCACTTGCTACGAAGACAATGGCATTCCTTCGCAATGCCAGTTTTGGCTTGTCCTTCGGCTGAAACGGATTGAGCAATGCA
ACGAGTTTGCTCCTTGCCAACTCCACTCGCTTCTCCAGTTTCTCTCGATCTTCCAACTCCATGCGCTCGATTAGCGCCATTGCTTTTGGAGGTGTTGAAA
CGCGTCTATTCAGCACCACGTTCCAATACTCCATTTTTTGCTCTCGCTTGTCGTACTCGGCCACCCACGCATATTGTGCTATACGGTTGAATTCGATCGT
TTGCAAGTACAACAAACGAGTTTTCCGAATAGCTCCTTCCAGGATCTGCAAGATTTTGGCATGGAAATCTCTCGTGACATTTAGCGCCACTTGTCGTGGT
GATTCGTATGCTTGGCGCAAGGCTGCATCTTGGTCGTACGGTTCGATGTCCTCAAAGTGAACAACCGCAGACCGGTTGGCAATCGGGACGAAAACCAGTA
CGTTCCCGGTGAGCATCAAATTCTGCGTCGATAGGATTGATCCCACACAATTCTTCCACTCGCCCTTCCGGATCTGCACCTGTTCGTCGTAGTTACACCA
TGTTCTGGCAGCCTCCAACGCACGAGCTTTTTGGTTCTCACTCCAGCGTTTCTTGGCTGGTTGAGAATTGTCAACTGGTAATCGTTGGAGGAACAGAGTA
CGTTTGATCGTATCAAACCGCTGCCTGCGTGCTGCAATTTCTTGCTTTGTGTCTGACTTTAACACCGGCGATACACCAAAGACCGCTTTCACCTTGTACG
TGATGGATGACCGCACTTTGTCATCCTTTTTTCGTTGTgctcgcgcagcttgagTTTGCCGCACTAACTTCATGTACGCCTTCCCGGATTGACGTGCAAG
GAATGATCGAATAAGCGCCTGAATTTTCGTGGCAGCAATATTGTGTCGTTTGAGTTCtgtttcttgctgctgcctctcttgttctcgctgtgtcttcctc
ctctctcGCTCTTTCTCGGCGTCGGCATCCCGCTTTTGCTCTGCTTTTTGTCGAAGGATGGAAAAGTAATTCAAGCGATGGCAGTGatgatgttgtcgct
gccCTTTAGCATGGTAGGAACTCATACATCGCTTGCAAAATACGTCTAAACAGGTTTCGCACGACCACTGAGCAACCCGATGAGAACACTCAGCGCACAT
GACCACCAGAGCTTGAAACTTGTGTTGGCTTTCCACGAGCTGATCTTCAACCACGTTGAGGTCTTGGTTGGCCACTACCCCGCCTGGGGTCACATTTTCA
GTTCGTTttgcctgctccagcagttgctTGTGAACGTGCGGAAAGCAGGGGTCACAGAAGGGAACTTTGCCATTTCCGCATTGAAGACACTCCCTTGTTG
CAGTTTCCGATCGGCAATAACTGCATTTTTGGATGTTCCGTGGCTGATGTTTTTGGAAAGCTTTTCGGGGTTTATGATCCCTATCAAAGCAGATTCGGCA
CATGACGTCTTCACACTCCACACAGTACACATCCGCTGGAACTTTTGAAGCATTGGGATTCGTACTGTCTTCATGGCGTCCGCAAAATGCCTGGAATTCC
TCACCAGGAAACGGCAATGGAACAATCTTGCCGCATTTTACTCCTTTCAAGAAAACCGGACGCTTGGTTAAGATTTTCCCGCTAGCAATGTGCTGGAACT
TAACTGCACGACCTTTGTGATCAATATGTTCAATAAACATGCCGGCTAGCATTGCCTTCAGCTGCGAGCGAAACTTGTAGCAACGATACGCGATTTGGAT
TGTCGAAGCGCAGTTACTCCGATGCGCCTGAATTTGCCGCTCACGAAAGATAATGGCAAACTGCTCGTGTTTCTTTTTGGTCGCGATTCTTCTGGCAAAC
CGCCGTAATACTGTCACGGACCAAGTCAACCGTTTGGTGCAGTGCGTGCCCAACGTTTTCCTGTATTTTCCATTCTGAATAGTAGACGGCAGCACAAAGC
GATTCATGAACCGGAGGAAATGTTCATCGTCACGAACCGTATCGGTAGGCTCTGAACCTTTCACGGCATCCTTTTGACTGCTCTTGCCTCCAAATTTCTC
TTTGAGCACCATTAGTATAGCCTTGTTAAATCTCGGATACGAGATTGTCTTCGCCTTCGGTTCTTTCATTTTCGCGAAAATAACATCAGCGTTCTGCATT
GGATAATTGGTCTTGTGGATGAACGCGTGTGGAAGAGCCTTTAGGAATCGCGCGAAATGAGAATTATCCATTTCCAGCGAATTACCAGCGGCGTTCCGAA
AGACTTCTTGCCAAATACCGTCATAGCCTTTTCGTgtccacagcttcttcgctaGGTCCACTGCAAAAAGTGGTCGATCAACACGGGATTCCTCCTGTGT
ATTCCCTTCCTTCTCGTCTGCAATTCTACCCGATTTGAAAGTAAAGCTTTGTAGCAGTAGCTCATCCTTAACACGGATTCGAGTCCCGTCCTCCAGGGCT
TTGCCCACAGCACCCTCTTCTGCGAGATACTGACGACGTCGAACCACTGCAGCTAACATTCTTCTTCCGATAAATCTCCGTGCCGCTCGCTGAATAATTG
CAGCATTTAATGCACGGAACCGCTGGTTCTCAGTATTTCGCCGCGCTTTCCAATGTGCTTGAACTCGGATAATCATCTTTATGGCGTATCTCGTTTGCAG
GAGTTGTATCCGAGTTTTGTACCCTCTCCACACTCGTTGTATACGTCTTGCACTCCTTGCTAGCATTACCCGCCATGCATACGCACGCCCTCTTATTCCT
CGAATACGTCTCTGTATGCACAGCGCCGCAAGTCTTCGCTTTCGATTATTTTCACGCCGCACCCTCTCCATTGCTCGAGCTTTTTCATACCGAAGTCGTT
TACGAATTTGTACGCCTCTCCATCTCGCCTGCAGCTTTCTAGCAGCTTGAACCTCTTGTGAATTTGAGGCATCACGTTGGTATGTATTGGCAGCTTTCAA
TAGCGAGACTTGATCCCACTTCTTCTGCAACTGTATCGGACTGAGGATATTAttcttcctgctgcggcGATTTTCCTCGATTTCTTTTAATATTTGGTCA
CGTCGAGCCAATGCTTGTTGCTTCCGGCTCAGTAGCTCGCATCTGGCAAGAAAGCACCTCCACGAACACTGGAGTACAAGAACAGCTCTGCGAACATCGT
GCTTGTGCTTAATTGCCCATCTGCGCGCTTGTTGGCCTCGATAGTGCGCTTGAACCTTGAGTATTTTTTTCTTGTCACGATCAAATgttgcacgacgacg
acgaagctttAAAatttgcttctgctgccaaTCGCGAAATGCACGCTGTATCGAAATTGCAGCGCCAAGCATTTTCGTATTCCTTGCTCTCACTGCAATA
CCAAAAGCCTTTTGTCGCCGAGATTTATCGGCATGGTCAATCTTGGTGAGCAAAAGTCTTCTTCGCTGAGCCAGTATCCGCCGTGCATGCTTTTGAATGC
AAATGGCTGCTttgtgctggcgctgccTGCGGATCTCTCGACGTAGAGCTATCCACTCAGCGCATGATTTTCTCCAAAACTTTTGTATACACGTTGCAGC
CTGCAGTCGACGTTTTGCTTGTTCACGCAATAGCCGAAGCACATAATGTCGTATGCAGCGCGTTATCCGGCAGgccgcttgttgctgtttgcttGCAAGT
AGAGCTAGAAATGCCTCTTGTCTGCGTTGCAGCTGGTTGCGTattcttctccgtcgtgcAACTTCGTTTTTCGCGCTTATctgccgccaccagcactgTA
GACGTTCACTAGCCAAACCCCATTCTTGTTCTCTCGTTGCAAGGGTAAACTCTTTCCAACGACTCATTCCTAGGACAAGTAGTTTATTTTTTAACCGAAC
TCCAGCGCGAAATAAGACCTCAGTAGCTCGTTGTTGAGCTGGCGACGCAAATTTTCCAAGTCCACATGCGTAAATCACATCAAGCGGGATCCACTGCTTG
ATTTCATCGATGGTTTCTTTCACTTGGTGCTCGGTGGCTCCGTGTTGCAACTCTACGTGATGCTTCTCCTGAACCAATCTGTTGTACGTATTAGAACGCT
TCAGTTTAGAGTTCTGGCCGTGTTTATTCGAAGTTTTCACCGCTACTTCATCCCTCAAATCGATACCAATTAACCCGTCTCTCTCCAGTTTCGTTTGCTC
AttcgcttcttgcgcgggattcttctcctccaccgaTATAGCAGGTAACGTAGCTCCTCGAGCAACAAGCTCCTTTCTCGTATTAAATGGCTTAACAGCA
CCGCGCGgcctcttcatcttcctccgtGGTGACGATCTAGCTATGCTCTGCACGTTCATCTCCTCCGCCAGAAGCCATCGAGcttgctgcatcttcttcc
tcttcattTCGCGATAAAAATCTTCAAAAACCTCCGGGTAGTCCACGGAACGCTCAAAACTCTCAATGTCACGCATCTCCGCGTCACTAGGAGGTGGTAG
ATGCGCAAGACCACGTCTTGTCCGCGGCGAAATAGTTGTCAACAAAGGCAGCAccatctgctgcatctccttctccacaaaATCCTCAACACCAATAGAA
CCTTCGTTGTCCTCTACCacatcttcctcttcgtaGACTCGACCGCCATCCCGCAACTCTGGGTTAACCCGAACGTCCTCATCGGCCTCCATATCTCTCT
TCACCTTCAATTCCTGCTTCTGgccgtcttcagcttctcttAGGATGTCTTGGATCATATCTGGTTGGTTTAAATACTGCGTTACAGACAGAGGAGGGAA
CTTTTTCACCTCTTCCACactgtcttcttctctagACAACAGACGCGGTCTGGCTGCCGTCTTGCCTCCTCTATTTTTCTTGTCATGATTGCTTAAGTTA
CTGGAGAATCGAACTCCATCGCTTTTCAGAGCTGTTGCGGACTTATCCAGCACCTGTCGCCACTGCTTCGGGTTGAAGGCGACGCAGCCGTCGATAGCTG
CCGCCAGTCGCACAAATTCCcccgcagcaacagcgcgtgCATCTGGACGTCCTCTCTTGCTCAGCTGCGGTCGATCGCCGCCCTCCTTGCGTCGGTACGC
CTCCCTCCGCGCGACGGCTGGCTGCATAACCCCACCGCATTgacaataaaaaaaatggcaacttcaaccaAACCGAAAATTGCGTTTCTTATTTATGGCT
TGCTTGGCTATTTGTGGTACATTACCACAAATAGCAGATCTAGTTTGTGGTGGACAACACGCAACCTCACAGCGTCACCCCAGCCAGACAGACAGACATG
CTGTGCTCGCGCTTGCTCTCCGCCGTGACCAAGAGCGCGTCGGCGCCCGCCTCGCTGCTCTCCTCCATTGCCGGTGCGTTGTCAACTATTCTACACCTCC
GCCTTACGTGTCCTCATTGCGTAGTCAACAGTTGCTCACGGTGTCATTGTGTCGTGTTGCAGCCCGTCagcctgttgctgcagtcgctggagtgCGCAGC
GTGCCGTCCACTGCCAACTGGTTCGCCGCTGAGGAGACGCCCAtcgccatggagctgctcaaccGGAACGCTCGTCGCCCCAAGAAGGTACCAGCAGTTG
AAGGTGCCAAAGTGGAGTTTTGTGCTCATGCTCATCGTCATGTTTGTTCATTCATTGCCTGTTGCAGGCCAACCACGGCAAGCGTCCGTGCTcgcaccac
cgtcgccgtcAGAAACGTCTTGGAGCCAAGAAGGCATAAGGATGGAAGTGGACGAAGCGATACAGTTGCTGCAACCATTCTCCAATCTAGACACGACATG
TTCCTTCCTACTTTACCAGATCATTATTGCCTGAGtctcttgttgttgtgtgCGTGACAGTGGAGAGAGGAAGCTCACGTTGACACACATCTACATTTAG
TTATGGTTTGTTTGCCCTATCCTATGCTACACTCGACAATTTGCCACAAAAGCTCCGTGTCGGTCATGCCTGCGGCATGGGCTCGTCGCCTTGAGCCTGG
TtccgctgctcctgctgacGCTCGTTCT