Description :
From Genome Similarity Track
Location :
scaffold_21:378876- 384227
Transcript NameFunction/comments
Plaha_PHALS_10288hypothetical protein

Sequence
5351 bases(100 bases per row)
tgaccttagcgggatccgctcgaaagtCACGCTTCCTAAaaaagcaccacaaaaaggggatttcttccgcgccgaagatgcatttatcggcattagcata
cagcttactcGGACGCAGGCACTCGAGCACCCGCTTTATAaaggacgatgtgattttcctcatctgtcctcccgtgccccggactactgtggacgaagat
gccgtcaaagtatgtctgtgcattcgCACGGTGAGGCCTGGAGAACTGCGTCacgagacgattaaatgttgctggggCAttggacagcccttggggcatc
accagccactcccagagcatcccgctcagagtactcaccgctttcCGTCTAATAtcactcgatctcatgagcatttggtaatacccatcgaccaagtcga
gtgcactgtacaaCCAccttgttctggagaatatcctctctaggaatcggcgtctgttctggaatggtggcatcgttgagcttattgtaggtGTGAGCGA
TACaacacttgccgttcggcttccgaacccaaaacgtgggtgtcaaatagGGAGGCTTGctttcacgcaccatttctgcctCGGGCTTCGGCATTATGGT
ATTGAACACAGCATTCAAGTAAGCAACGGAAAAAAGGCCTCGataacgtcacactgcttcttgggcgCGGACCATTGGCacgttacgcagtatttggctt
tcGAAACTacgtcgatctcatgacgcacaccttggtccggacgtaggaccgacggcgagtctctggagacgacgtctgtAATTCTTTTACCGAAGAACAG
TTCAGATCCAAGGAATTCTTccggatcgacgatccacttcgtgcgttcagcaccctcttggtgtcctccattACAGCGACATCAAGAAgcaacgacgagt
tgatctcctcttccggtcgaaaaatgaccactttggctaagttgcctgccttcaaagcACTGCCAAACACTTCGAAGAATATCTCGTCCaacttaagaaa
aaaatctaccgcagaaatagcctcgagggtgacgtcgccgttatTCTACCCCGTcgaaccgttgacgagggtgtatagctgtgcacaATCGACTACGGTA
GACACTTCGTGACTCAGGGTCGACGTCcaacgtcttgcagctagcgtACAAGGTTGCCCTCGCCTCTCCACAgacgcagcggggctgccgtagctttgcg
ctagcggatcgcaatccgctgcctctaaaagtacttaaaagcctttaccaaggcaaatgaacacttatgttcaaaatcgaaaatgaaatttatttctatt
tttatcctaatgttaaaagttaagattttcctaaatatgttaagtgtatatagtaaaatctaaatacatgcataactactgggtacctagccccgtaccg
tattcctgtttgggtgtgtggtcgcattatgcacatctcgctTGACACGCGCATACCcttgttattagggttcgtgtaaccccgttacactctcccccat
taagattgagagcatttacagttccaatcaattattgcctcaacgaNNNNNNNNNNTGTTCATTTTGCAATGAATAGCAAGATCTGCAGAGTATGATGAG
TTTGCTTGCTTGTATCGAGCAACTATTTTCTTAGCTCTTAGCATTTTTTAATCGAAACTCAATTGAATAGCGCTGACGTTCAAGCACAGACGTTAGCGCT
ATTCAATTTTCTTATCGTGCAAAATCACGACAACCTGCGAGCTACGATAGCCATTCTAATTTTGATTATACTTACTGCTGACTTCGTTTTGCGGGATTTC
TGCATGACCTCGGTCGATATATAAGATTATCAATGATGTATGACTAACGTGTTGGTGGGTCAATTGCATATGATAAATCAAGAGCTTTGCCAAATGGAGA
CCTGTCTTCTTTAGATTTTGGAGAAAAAGTATCTCTTGCACTTTGCAAGATACCATTTGCAATCCTTATGTATTCTTCACCCACCAATTACTCCACATGA
AAGAGGGCTAACCCTTGCTTATTTAAAGGAGACGGTGAAGAAAGATCTTCTTTCAACTGGCTCTCGTGTGATTTTTCGACTTTGGCAGTTCTTCGATAGT
CTTATAGAGATTGCATCGAGTGGCCTAAGTGCTTCTTAGCAGTTCAGGGCCGTATTACCGGTCTTAAGCAGAGGGTAGCTCAGCTGAGTGAATCAGCGAA
GATGACACAGCACCGCATTAACATACACATTTTACCTCCGACTGACTCATAAGGGCCGATCGCTATACGTCTCCGACGTTTGATCTATTGTAAAAACGAA
TGCATGCTGGGTGTCACGTAGAGTCGACGTACTACCACAACTGGGAGAGATCACAAGATTCAGCTGCGGGGGGTTAGTCACTTTAACCCAAAACATTGGC
AAACCGACGGGTCTACTACTAGCATCTGTTAAAgcgaagatttttttgtaaGCTTGTAAAAGTTTGAGGTTCCTATTTGCCAAAATGTTCAGGAGCCGTC
GCTGTTTCAAAATAGGAAAAATCTCGGTTATTTCTTCCGGGAGGAGAGTCGGGGTAGCTTGTCGCAGCACACTTACCATTAGCGAGTAAGAACGACTTGG
GTGTGAGTTCAACACTTGGAGGTGGCTGTAAGAAATCTATCATGAAGACGATCAGGAATATGACGCCAAAAACCAAAGGTAAAGGTTTACACAACGATGT
CCACGCCGTGCATTgtccttttcaaaattgagcATCAGTCAACGGTCTTCTCGAACTTTATTTCACTGATGCTAAGTTGTAATTTCTGGAGGCGGGTGAA
ATAGTGTGTACATGGGTACGATAACAATCCGCATTTCCGCGAGCTTTCGGCATCCAAGGTTGAAGATTAAGATTTTTTCGATCGCTGCTGCTACAAGCGC
AAGCGGCGCTTCTTATGTATTAAGACCTACGTGATTTTAAAGCGATTGTTGGGTGACTTTGTTGCTCGCGCTTTTGCTGGCTTCGGCACTTGGTGTTTAA
CACAAATCAATTCACCTACTCCACAGATCATACTCGCATCAAAAGTCCCCACTCATGCACCTAATCAATTGGCTTACCCAGTCTTAAAATAAAAATGCGG
TTCTCGCTATAAAGCTTTAAATGCGAATCTCGGTGAGGTGGTCCGAGTCTTTTTCGTTAAGACGAATGCCAAACAAAGCCCTCCACCCTTCGCTGCGCCA
CTCTGCCTAGCCGAGTCCAAGGAGCATTAACAGCGCTCACCCACCGTCTGACTCAGTTATGAACCCCGTGTCTTTTTTTCAATGGAAAAAGTGTTGCGAA
AAATAACCTTGGATCGATCAACGACATCCGATTTTACTCCAAAATCTGTGGCTGGATCAGAGGTATCATTCTGTCCTATCACAATTACAAGAGTCATGTT
GACTGTGTTCAAAATGATAAAATCATAAAAACATTATCACGATTTCTGAAGTTGCTCTCTCCGCGCAATCGACGCCCACATCTGCCTATACGAGTGATCG
TTCCACCCTCACCGATAGCTCGAAATATCCACTTTTGGATTCATGAAACTTAAAAAGACGCTGCGCAAAATGAACTTGACCTAGTTCGACGAGCCCGGTT
TGCTTCTGTTGATATAGTCACAACCTAATAGGTACCGAACGACCAATTAAAGGTCATTGTGACATATGAGCTTGTCGACACTGAGACGGATAGACATCAG
ACTTGAGCGTTGCTTAATGCTTGATAATATGAAAAACTAACCCGGCATCGTCGTCGATGCGAAACACAATCTTATTCCCATCTCGTACGTTCAACTTCTT
TTGTTGTCCTCGTTTCCCTACTGGTGCAATTCTTTTTTTGTAGAAAGCCCGACCTTACAAACATGTTGCAAGTCACCATCCTGTCTTTACACAGGTAAAT
CATGGCAATATGGCTGCTAAACTACATCGCAAAGACAATCCTGCTGAGCATGAAACTTTTGAAAGGTCTCGGAGCGATGTTTTACCAATTTCAAATTGCA
GCGAAGATGAACCTACCTTTCCACTATCCGCAAAACTCGGAAGTATATAATCCAATTATTATTACTATACAGGGCTCGCGCCAAGCGATCCTCACGGAAC
TACAACTCATAAAATATTCCAAATAACGCGACGGGGCCAACTCTCTTCAAAAGACTCGGTGTGTTGTCTTTGCTGCGATCGATTTGGTCATGGATTCCAT
GGGCTGCACACCGAACCACTACTCAAGAGCCGGAAATGATTCTACAATTGAGTCTTCAATAGTACGCTTCATATTCCTAATGTGCAAGGAGAAGGGTTCT
AAAAAATAGCACTTAGATTAGCGGAACCATTAGTCAGAACGTCGTATTTCGAGTTTTGGTATGCAACAAGGTTCGAAGGCTCTCGCAGCGGTcttcaagc
gtcgagcaacgctgctgcaGTGCCTCAATTTGCCCGCGAAGAGCACTCTTTCACTTCCAGTGTCGCTCAATCGTTTTCTCGTTCAGCCCCACCCCCGCTA
TTAGACTTTAGAAGAGATCGTCGCTGGGTGGTTGAGACATTTGTCGATCTCGATAATCGATCGACTCGTCATCATGGAAAGAAGCAGCTGAACCATCAAT
GATTCTACAGAGACCCGTGGCGCGGCTATCATTCGGAGTCGGTCACGTAGGAACCTCGTCAGGCCTTTGAGTCTGATGTCTCCGAAGCTGTCCACGGCTA
CGAGAATCGCTTGAAGTGTTTTCTCTAGCAACATTACGAAGCTCAAAGCTTGATTGTGCTCGGTCGTTTCTGAGAGTCCTGCCAGCGCCGACCCGGCGAA
GCAGACGTTCCATTTTGTTCTCGTTCTCAAGGCGATCAAATGTCCTCCAGGAGTCAGACTTAGCTGCGATGAGCTGGGTCGGATCATCACGGTTGATGAG
CTGGGCTTTCATGTTGGCTTGTTTACTTTATCGCTCTTTGTTGATTGAAAAGTGAGCTGCTCTAAGAGGTCTACAATAGTATCAAAGAGCTTTAAACTTT
TAGGAGGGTATGATGTAATaggctacacttagccattacatgaaaaaGGTACATAGTACCTTTTTGTTGGTGTAGTGGGAATTAATATAAGAAGATTGCA
GTATGGTGTccccaaatgcatacgtgatttCTTATCTGaggtcacaaacattcttcGTAAGGCAAAATGCTGGTTGCTACTTGGTGATCTGTTTTGGTGA
CGAGGCCGTcatgtctctgtcttttagaagtgggtggcgtaatTAGTCACatctactggatactttccacaaaagttgaagctcaagcATTCGAAGTAGG
TGGCGTAAGTCAGTCCCTTCTACTTAAAAAATTCCACGATAGTTGAAGCTT