Description :
From Genome Similarity Track
Location :
Scaffold_84:37887- 40684
Sequence
2797 bases(100 bases per row)
CCACGCCTATCCTCCGTCATTTTGATCCAGAACGTCCTCCTACGGTAATAGTTTATACCAGCGACTGGGCTGGCTCCTCATCTCTGGTACAAGAACTTGA
GGGGATCTGTCATTCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAGCTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTG
TTGGATCTGAATTACAACCTGCCGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGAC
GTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGAAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCAAGCAT
CACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCAGATCCCGACGGTACAGGCAGAT
GAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGGAGACTACCTGGATGGGAAGTTG
TACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAA
AAGGCTGGTGATTTGAGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACGGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTG
ATGATCCACCTGCGCGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATC
AATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGCTGAACCGACTAGACGAAGTGGTGGTAGTGGGATCCGGGAAAAGGACAGT
CCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCTTCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCT
CAACGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATT
ATCGCTACAGATTACGCGGTGGATCTGAATGATTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGTTTGATGAGACTGGTGA
TGCCGGAAACCTAACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATG
TTTTCACTGGAGGGAACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCA
CCTGAGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAGGAAACACAGAATTGTTGATTTG
GGTGGACCAGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAGCTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTT
GGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCA
TGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACGACAGCACTCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTG
GGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAA
TCCACCCTGGAAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCGAGGCGATGGCGATACCAAGTCCAAAAATACTACCGGCAAGCTA
GATCCCAGGTATACGAACGACTGCGGAGTGCGATACAGGATCGAGCAGATCGACACAACGAAGACGCCCGTCCACATCAAATTCAAGTGGGATCGCAGGT
GTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCG
GTAAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAAATCC
GTCTTTCGGTGGATGGATCCGATCGCGTCGACTTCGACGAAGTCCTTCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGA
GAAGATCACCGATATGAGGTCAGGGAAGCGAACTAGATACCGACGGATCTTCCGCGAATTTTCCTGGGGAATTGGTCGTGGAATATATCGCAACCCAGTT
GGGTAGAACAGGCAGAATCTGAAACTGTGGAGCAATACTCCTATGTATTTCCGAGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCATTTCTCATG
AAGAAGAGTAGAGAAGGGACCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAAAAGGGCCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGG