Description :
From Genome Similarity Track
Location :
Scaffold_1326:3788- 7904
Transcript NameFunction/comments
Phypl_g13118hypothetical protein
Phypl_g13119hypothetical protein

Sequence
4116 bases(100 bases per row)
TTGAACTCGTAAAGTAAGTTCCACAGTTGAGTTGGGACACCGGAAGCCATTGTAACTCGGGATACCCTTTCCACTTGACCAAATATTCTCGGACTCATTT
TGAGGTGCGGGTCCGTTTTACCCAGCGCACGTCCCTGATCGCTTCCACTTCGTACACACCATGACCTTCTTCTGGTTCCGACACATCTTCTGGCAACAGG
GCTGCATCAAAATCATCTTCCTCTGCAAGTTCCACATCGACCTTCGGGCGGTTCGGGAACAGGGCACGCGGTTTTAGCCTACTCACATGGACCCAGGGAT
ACAGTTTATACCCAGAGCCCTCAATCTTCAGCTTACAGCGATAGTCCTCAGAAGCTTCCAGGATGCGGAACGGGCCATGCCAGAGATGAGCGAATATCTT
GGTTAGCCCCAGGTTGGACGCGTCCCAGGTACAACCACACAGCGTCCCCGACCTGAAAACATTTCTTGAGTCTATCAGACAACTCATTCCAGACTTTGGT
CTGGGTCTCcgagcgcttggccttggctTTAGCTTGAAGATCTTTAGCCCAGGCTTGAGCATACTCATGCTGTCGTTGTATCACTCATAAGCAGTTTTCT
GATCAATCCTAGTGGGAGGAGGTCCGAGCATAGCGGAAACCGTACTCTGAGGATCCCTGCCATGAACCAAATAAAATAGCGTATCTATGCGTGTGGCGTC
GAAGGAAGTGTTCAGTGCCCACATCAACTTCTCCACCTGATCGTCCCAGTCGCTTTAATCCGGTTCAGAGACATACGCTCGAATGGCTCGGACGACTGTT
TGCACCGATCGCTCCTGCTGGCCATTAGCTTGGGGCTGATACGCGAGTGTGGCCCTCTGCTGACTTCCCAGCATTTCTCGGAACCGAGTAAAAACCTCGC
TCATGAATCTCGGATCTCGGTGGTGACGTAACATCACACTGGTGCCAAATCTCTGGAAAACACATTCCATATATGCTTCCGCCACTTCCTGGGTCGTAGT
TGTACTCATTGGTCTGCAGATCACGAACCCCGAGAACGAACACTGGAAAAACAACAAGAACACGTTCCCTCGGTCCGACTTGGGTAAGTGTGTCACGAAG
TCCATGGAAACTACTTCAAAAGGGCGAGTCGCCAAAATATTCCCGGGTGAAGTCCCAGGATTAGGAGGAGCTCCCTTCGCAGTGACACAATCCACACATT
ATTTGACGAAACGCTCGACATCCGCGTACATTTCGGGCCAGTAATACTCTCGTCGCAGCCTTTCAAAACTCCGAGTAATCCCTTGATGGGCTCCTTGGAA
GTCCTCATGACACAAGTGCAAAAGATCCTTTCAGAGCGTGCTGGGAACTACCAGCCTCAGGTTTCCTTCGGCATCTCGAGGTCGACTCGGAGTGGAGCGG
CTCAGGTAATAAAAAGCTCCTCGAGCATTCAGAGTAAACTGGTCAGCGACCTTAGCCTCTTTCTCGGCTTCCGCAGCAGAGAGTGATTTCAGATGTCCTT
CCAGATAATCCCGGAGTTTCTTCGTCCAGGGTTCAGGTTCTTGGTGAGCCAGGATGCGTCTCCACCTTTCTGCGATAGAGTCTACCGGGGTTGTTGCTTC
AGGTGAGTACACACCTCGAGCTGTTGCCCCAGGTTCATTGGCTTGCCTGTCGTCACGATCAGCATCACGGCCGGAAGTACCACGGTTGCGAGCTTGGCTC
CGAGTCACCATAAAAATCCGGGAATCCGGCGTCAGAggatcagcagcttcagctaACGATACCAGTCCAGCTTTCATGCATTCATCagacgagacgctgg
agtCTGGATTTCCGTCAGGTTCCACTTGTCCAGGTTCGGGTGTCTTCAATAGCTTCTCCGGGATCCGgttcagctgcttgagctgagCCAGTTCGACCGG
ATCATCTATGGTCACTGAACCTTTAGCCAACATGGTCTTGGTGGTCAGGTaatctgctgcagcattaAATTCCCGCTTCACGTGTACTAGTTTCACAGAC
TTGAAATTCTGCCGGAGACCATCAAATTCTGCGAGTAACAGCTGCAACCCAGGTTTCAGACATTGTATCAAACCTTGGGCTTGCTGAATCGCGATTCGGG
AATCTCCCACGATAACTAGCTCTGTGAAGCCTCGGGTGATCGCCATCCGAGAACCTTCAACTAGACCATGATATTCGGCTTCGTTCACCGTGGTACCTTC
AAAGTGAAACCCTCGAGCCTCAATCACGTCCCAAGAAGGGAGCTTCCACAAAATACAACCAGAACTTCCTCGCCGATCCGAGAGTTTAGCTGCTCCATCA
AAGCTCAGGAGCCAGCCCTCATAGTTGGCTTCTAGCATCTCTAGACTGATTGGAGAAGCTCGAACTACGCGTCCCTTGGCCGGGATTAAGTTCTCGGCAA
TCTTGTCAAGTTTGTCACGCGGAGTGATCCCAGCTCCCATGATCGCAGCTAAACCATCTTCATCACGCTGGATTTTATGTATTGTCAGCGGCCATGGCGA
AAGCCTAGCTGCCCACTGCTCGCAACGTCCTTCCAGGGATCTGGACCGGAAAAGCCACTTCAAGACCGAGTATCTGGTGTAAACCCTCACGAGCCTACTG
TCCACCAACATGGTGTAGAACAGCCTGAGAACTCGGAGTAAAGCCACAACTTCCTTTTCAGCTGGGTGGTATCTGAGTTGCTGATCATGCAGCACCCTCC
CGGTCAAACGAACCGGGAAAATGACTCCATCGTACTCTTGACCGAGTACAGCACTGGCAGCCCAAGGATTCGCGTGGATGATAATCACGAACGGTCTTTC
CTTGTCTGGGTGTCTGAGCAACGGAGTGGAAACAATTTTCTGCTTCAGGACCTCGAAAGCTTTCTTAGCACGACCTAggtctcgtccagcttggaTCTGC
TCGTCTGTCAACTCGTAAAGGACTGATGCCACCACTGGGAGGtcctcgatgaacttgcTGTAGTAATTGAGACTTCCAAGGAACGACTGTACGCCTTTTA
GAGTTGACGGGAACGGGAGATCTTGCACTCCTTTGGCGATTTTCGGCTTAGCTCGGATTCTTTCGGCTCCAATTTCATGAGACGGATACGAGATCACCTT
CTTACCGAATTCGCTCTTGGGCAGACTCACAGAAATGCCCCAGTAACGCAAACGATACAGCAATCAGTCCAGGTCGATACACAACAGCTCCCAAGTCTCG
GCTCCATACGCAATGTCGTCGATATAAGAGCTGCGTCCCAAGACAGGATTTAATTCAGGTGGGGCTGGGATATTCCTTTGGAACACGGTCATGTCTTCCG
TCAATCCCGGAATTTCATATTGCGTCTCCCGAGCCTCAGCCTTGATGCCGAGAATCCCGACACTTCAGCGTCAACCTGAAATTCCTGATCCGTCGGGAGT
CGAACAAAGCCCCAGAGACAGTTGTCCAGCATCTGCTGATAAATCAGTGGAGCGTTCTTCAGGCCAAACGGCATCCGAGTCCATTGAAATTGTCCCAAGG
GGCAGATGAACGCCGAGATCAGCTTCGCCCGAAGAGTCATAGGCACAGCCCAGAAGCAACTCGCCATGTCCAGGCTCAGGAACCGCATAGCATTCTCGAA
CCCAATCAACAGATCGTCACTCAAGGGTAGAGGGTAATGCATGAGCTTGATGAGCTGGCTCACTAACCGGTAGTCGATACAAAGTCGAATATCcaccttg
tccttcttcatcacAATAACAATCGGGGAAGCCCAGTCCGAGTTTGAATATTCGAACAGCCCagtttccagcagcttcttgagtAAGTCATAGAATTTTT
GAAGATGATGCGACGGAATTTGTCGAGACTACTGGGCTATGGGCTCAGCGTCACCTACGTCCAGGTCACAGACAACATCTCTGGCCGGCGCCGGGACAGC
ATTGCCGTCTCCGAGGAAACTCGCATGATGTCGCTTCAAGATGGCTTGGATTGGGTCGTCCATTTCCGGAGTCGTCTCATCGGGGACACCTACATCAGCC
TTCGTCAAATCAGCAACAGGACTGAGATCCCTCAATTCTGGGAGTGCTGCAAGCTGGTCTCGAAGGTCACTCAACAACTCACCACCTTCATGAAAATAAA
CCGTGGCTTCTTCGTC