Description :
From Genome Similarity Track
Location :
contig_164:3788- 4989
Transcript NameFunction/comments
g13977.t1hypothetical protein

Sequence
1201 bases(100 bases per row)
CGCAGTCGTTTTTGTCGTCCCAGGTGAAAAGCACTGACCCACGCATCGAGATACAGCGTCCTGCAGCTTGGTGGCGAGGCTGTTACCTTCCTCTCAGCGA
CCAGGTGAGGGAATACCGTCGTAGCGTGTCGGCAGAAATGGTGACAGTTGTAGTCGTGGTTGCCATCACCAAGTTCACCGAACCACCAATTTCCAGGCGC
TCGAGCTGGATGTTGATATTGTCAAAGTAGACCGAGAACAGGCTCCAATTCTCCAGCAGTGCATCCACCCCGCAAATCGAGCCGTCGGTCACGTCCGGGG
CCATAGCGTTTTGCAGAAAGCTCAGCACGAAGTCACGCAGCAATGGCGGAGGGGACCTGAGGCCAAAGCGGAAAATGCGGAAATACTGCATCGCCACAGT
CCAGACTGTCTGTGTGGTGGGGATGCCGATGTGAGTGTTGCATCGCTTCAGCTCGAGTTCCTCGATCTCTTGTCGTAACTTTGAGTTAGCGCTTTCGAGG
GCGAGCGTCAACATGCGCTGCTTCTTCCGGTACCTCGCCTGGTTCACTCTGCGACGTTCTCACTGTACTCGAGTGTTTTGCTGGTGTTTGCTGGTACTGG
TAGCTTCGTTGGCCATGCAGGGTTTCGTGCAGGCTTGGAAGGGTGCTTGGGCATTCATGGCTTCCGGTGGCGTTTCAATCATGGCCACAGCGGCGTGCCT
GCGATTCGAGTTTGAGCGCTGAGTGACAGCGCAGATCACATTATCACTCAGCGACGTGGTGTTGGGCGGATATAGCGAGAAGACGGGCATGGCTAGCTTC
AATGAAACTTTGATAATGATCGATGGTCGACTGAACCACACGAGGCGAAGGAGAGCAACAGCACCACCACGCGATTATGACGTCCAGGTGTACGGATGAA
TACTAGTAATAAACAAGCATAACCTCACTGAGGTCGTAATCAGGCAGAGCATGAGTGATCCTGGACCGTGCTGATAACAACGCCGTGCGCTCTGAAAATT
TGAAGAGAGTGAGTACATATACTTCGAAGTGTACGATTATCATGCAAACGGAACATTCACGTGGTCACTGCCTTGCTGTCTTTTTAAAAGACCGACCCGA
CCACCACTATTAGCTAGCTGTACACCGAAGCTGTTGCTTGGCGAAGCTTATATGTTTGAGTTAACTGCTACGAAATGGAGTGTTTGAAGGAAGCAGCACT
C