Description :
From Genome Similarity Track
Location :
Scaffold_48:378781- 386450
Sequence
7669 bases(100 bases per row)
CTACCTATAAATATACTCAGCTTACAGCCTACCTTAAATTGTTTTTTTTGTCACCTCGCTCCCTTTAAGTAAAAAGGGACCTGTGAACTGCCGTTCACTG
AGAGTTTGTAAACGCTCGGAAGCCAACTTCCTCTAGTGCAAGGTGCTGTGTGACCCCGTTATCCTTGATAGCACTCGTAATCAATCCACGCCAAAGCGGG
TCGACTACCTGAACCTCTCTAAGATTTGTTGCCTTGGATATGAACAACATTTCCCATCCGAACGGCTCACAGTTCGAGTTGGTTCAGAAGATGGCAGGTA
TCTTCGAGATGGAGGCCCTGCAGAGCCTGGTGGCGTCAACACCGGCCGCGCAGCTCGAGCACGTCAATGTGTTTGACGCTTACGAGCAGGGTCTCATCGC
GCATGTGCGGGAGAACCTGCAGGCTCCGGCGGTGGAAGCGAATCCATCTCACCCGAAGCCAATTCGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGC
GAGAGCCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCTATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCCTTTGCACTCTCCAACCTTA
GCGGCCGTGCTAAGGGTTGGGTGTACACATCCCCTGGATGTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCTGCGTTCCTCCCGGCGAACTACG
AGTTATGCCAACGCTCGCGCTTCCTCTCGTGCAAGCAAGGGAGGCGTGAGCTGCACGAGTACTTGCAAGAGATACGGGAACTCACGGCGTCCCTAGTGGG
AAACCCACTCAGCAAACACATCAAGATGACAGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCGCGCACTCAGCTGTTCCGGGTGCAGTCAAACACCCTT
GAAGAGGCGATTCAAGTGGCTCTTCGGGAAGAGTATAGCCATCGCCAGGCGCGTACGCCGGCCTCGCATGGCCTGGGAGTTCCTTGTCGACTCCCGGTCG
AACGAGCCCCAACGGACCAGTTCCCATTGGAACTCGGCTCCACCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGA
CTGTCCCGCGGAAAGACTCCGCAGACGATCTTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCAGGATCTCGGGGGCAGGGGAACGC
CGGAAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCTTGATGGGTGCGCGGGTAGCGCATACCACGGGTACTTAGCCCCTGAGAGTA
TTCGCACCCTCGAATCGGTGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTCAGAATCTAGATCGATTCTGG
GGCATCGAGGAATTTCGCACGCCGCCAGACAGTTGCTCGTAATAGCAACAAGTTGTCCGATGTTTTGAGAGAAAGCAAGGGCAACGGGACAGTATCAGAG
CGACCGGCTGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGATGTCAAGCTTGAAGAATTTGACAGCCTCGAAGAGTTCACTGTTCTCG
ACATGGATCCATACGATATGATCCTGGGCATGCCCTGGCTGAGAAGCACGAGCCCTGGATCGGCTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCG
CAGCCCGACAGAGCATTGGTGAGTCATGTTCCCACTTCTGTCGGAACTCAGGGCGCTCGCAAGGGTTGTCGGGGGACCAAAGCGTCCGGCAGATGCTTGG
GAGTCGTCGACGTATATGACGACTCCAAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGGCTCTGGCCAAGTGGGTAACTTGGGTCCACAAGCGGGTAA
CTTAGTTCCGCAGACAGCTGCAGCTATCACGAACTTTGACGATAGCGTGTTCCGGGTGGGTAACAGAGTTCCACACACGGTCGCCCAGACCTTAACTGAA
GAGGAAGACGTCGAATACGCTTCCTGTGTGGGTAACATAGTGCCACACGCGATCGCCCAGACCTTAACTGAAGAGGAAGGTGTTGAGCACGCTTCCTGTG
TGGGTACCACAGTATCACACGAGGCCACGAGTGCCTCGGATGTCGGAGCGCCGACATCCCCAGACGTGGGTAGCAAAACTCCACGTCACGGTCGCCGTCG
ACGACGACGTCGCTTCAAGCGACTCGGAGTCCAGTGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCGCATCTTCGATGGCGAGACCGGCTT
ACTCGTCAAGGCATCAGGTGTCCACTTGGAGCCGTTGCCAGAGGTTGCAGAGATACCGAACCTCGAAGAAATGACGGCCGAGTCTTTCCTGGCCAACCTC
AAGGCTGGGGAGATTGCCGAGATGGTGCTCATTAGACCAGATGCCACTCGGGAGAAGTTGAACTACTCCTCTGTCTTGGACGAGGACGTCCTAGAAGGTT
TGAGCAAGCAGCGTCAGACGCGCTTGGGCTCTGAGTATCTTAAGGACCCCCAGGAATCCAATGAAACAATACGTAGCGGAGTATGCGGACGTGGTGAGCA
AACATCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCATGAGATTGATCTCGTGCCTAACACAAAGTATTGTGTCACGAGGTAATGGCTTGATGC
CTTCTTCGCTGCGAAAGCGAAGGCATGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGATGCCAGCTTTCTGCGTTCGGAACCCGAACGGAAAGTGCCGT
CTAGTTCATGCTTATAACAAGCTGAACAACGCGATGGTGCCGGCCCAAACACCAATCCCACGAAAGGACGTGTTGTTAAACAACATGGCAGGAAGCGTAC
AGTAAAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCTTGATGCGTGAGAGCGACATCCCACTCACCGCGGTGGGCACTCCAAGCGGCATGCTTTG
GGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACACCCCGGCGACATTCAATAGCCTCGTGACGCAATTGTTCAGGCCACTGCACGCCTTCGTACAGACG
TACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGACGCAAGACGGCCATGGAGGTGCATCTGGGCACCTCCGTCGAGTGTTGGACGTGATGCGAGC
GAGCAGGCTTTACGTCAACATCGACAAGTGCGTCTTCGCGTCATCAGAGATTAAGGTTCTCGGTTGCTTCGTAAGAAACGTGGGCGTTCGGGCTGACCCA
GACAAGGTCAGGGACATAGCAGCATGGCCAACGCCCCGATTCCAGAAGGATCTTCGAAAAAGGTTGGGCTTGACTAACTATCTTCACAAGTACAGTGCAG
GGTACGGGGGCCTCGCTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACGTCGACTGGCTCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGC
CAGCCTCCCAGAGGCTCCTGTCCTGGCCATGCCGGACGAGACGAAGACGTTTAGCGTCGTCTGCGATGCGTCCAATTACGTCATCGGGTGTGCACTGCTG
CAGGTCAACACGGCTGGACATGAACGAGTCATCTCGTTCCAGTTCAGGCAGGTCAAAGCCGCCAAACGGCACTACCCTGTCCACGACAAGGAGCCCCTGG
CAATGCTATATGCCCTTGTGAAGTTTCGTGTTCACCTTCGGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCATCCTTGAGGACGGCGACTAACTC
GCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTTCTTCTTCGCGGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAACTCAACGTGATTGCGGAC
GCCCTCAATCGGCGTCCTGACTACAAGTTGGCCCACATCACACGGGTGACAACGGATCTATATGAGCGGATATGCATGGCGTATCGAGACGATGAGGCTG
TCGCGCCTATCGTCAAGTTCCTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGA
TGGCCTCCTCTATTACAGGGTGGAACCCTATGAACCTCCACGGATGGCCGTACCCAACGACGAGGATCTGAAGCTTGATATCCTCGCGGAGGCGCACAAT
GCGCCCTCCAGCCGCCACTTGGGTCGCGATAAGACCTTTCGGTCGGTCTCTCAGGCCTACAGGTGGGCCCACATGTATAAGTGGGTGGCACGATACGTGA
AGACATTTGAAGCATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAAAGCCTGCCCGTACCGGCTGACTGTTGGAAGTTGATGATTCT
TGACTTCATATTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGCCTGAGCAAGATGTACCATCTTGCTCCGGTTCCC
GTCACTGTTACGGGCGGCAAACCGGAAGGTTGCTCGTCGATAGGGTGTTCGCTATCACAGTCTCCCGGAGACGATTGGCTCGGACCGAGACCCGCGGTTC
ACGACTGCATTTTGAGCAACGCTGTTTCCTTTACTTGGAACTCGTCTGCAGATGCTCACTGCGGATCATCCGCAGACAGACGGGCCAGACAGAGCGCGTC
AATCGAGTGCTCGAGAACACTCTGCGCAGTGTGTGCGCAGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGCGTTTGCGCTCAGCAAACGCG
GTGCACGCGTCCACGGGGCTCACGCCGTTCTACTTGAACAGCTCCCGTCACCCCAGAGTGCCTCTCACGCTTCGAGGAGACACTGACTCCTCCATGCTAA
GTGAGGGAGAGGCTCGGAAAGCCCTTCCCCCCAACCCTTGGGTGTGAGACCAGTTTCGCAGCGGAAACAAGTGGAATCCGTTTTGGATACCAAGCTGAGC
ATTATCAGCAGGGTCCGCGATGCAATAGCGGCGGCCCAGAATAGACAAAAGGAGTACTCCGACAAACATGGAAGAGGAAACTGAAGTGTATTTAAAGTGG
AAGAGTTAGTGTTACTAGCCACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGT
CCTGGCCAGACATGGTGCGTCGTACACCATCGCCCTCCCTAAGTCAATGACGGCGCACCCGACGTTCTATTTTGGACGCCTTAAGCGGTACTTTGATCCG
CAGTGGTTGCGGGCTCGCAGACCCACCTTGGCCCAGCTCCTCGAAGCGAGAGCCGACCACAGACGTCGACGAAGGCTTCGGAGCAGGCACCCAAGCCTTG
GTCTGAACGGCAAGGTTGCGGTCAAGACTGTACGCTGGAGGGGCTCCGTACGAACGGACCCCGGAGCCATACGCCGAGTACGTTGAGTACGCCGGGTACG
CACCATACGCGTACGTCGGGTAGTGCGTCGAAGGCGGCCCCGGACGTGGCAACAGACGATCCGTCGGATCATGCGGAAGGCCTCGTCCAGATCGGACGAA
GAGGCCCGGCGATCCACCCGCAGATGCAGGCTCGCGAACTCACGCTACAACAGGTCCAGGCGGGCCGCAAGACGAGCGAGATCGCCCTGATCCCCGGTCT
GGGCGGGAGCATCACCGCCAGTCCTAAGGCCAAGTGCAATCTCAAGCACGAGGACGCGTTGACGAAGGCGGTCAACCTAGGGTCCTACGTCGGACCAACA
GGAGAAGCGCTCGGTCAAGAGTAGCGTCCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGACACCTCTGCCCCTGCTTGACCGGAATGGAGAAGTCCAC
TTCCACGTGGAGCGAATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACACCGAGAACTCGTGGGAGC
CGATTGAACGACTCCTGATTGACTGCCCGAAAGGTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTTCCCGAACGG
GGTACGGACACTCCTTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCACGCTTCAGGGTGTCCCTTGGCAGCATGCGCTTGCTGGAAAATTGAACACGAA
GATCACGGTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTGAGAGACTCCACCCAAGCCCAGAACAT
GTCCCCACGAGAACGCCAGGTGGGGCATTTCTCGGGCAGAACCCAGATGTACCCCCAAAGAGGATAGAGACCACCCCGGTTCTCGGGCTTCTTACGACAC
GTAGTGAAGGCGTTAAGAGGGATGCGTGTGGCGCGAGAAGCGCGCACCGAGCCGCCTCCAAGTTGTCAACAAACAACTGTTCCTTCTGGGCAAGAATACG
TTCGTAAATGCCCCTAGAGGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCCAGGAAGAGGTCAGCCCCAGAGCTCTCCTTGGAAGGCCAA
TACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAGCCCCCACGCGAACGCTGGGCAGCTTGTAAGTTCTCCTGCTTCTGGTCGA
GGTCATTAGTGATCTCCCGGGGCTCCAAAATAGCACCCTCCTCCTCATCCTATTTCTTCTCCTTCTCATCCTCTTCACCCGAGGAGTCGAAGAGGCCCCG
ATGGGGGTACCGAGTCTCCTTATCCTCGCGGAGTGGAGACTTCGAAGCCATACGCTTCTTAGAGGGCTTGGCGCCTTCGGCTTTCGCGGCCTTAGCACGA
GCAAGTTCCTCGTCAAGGGAGAGACGGTTGCCAGGCTTACCCTCCTCGTCGACACCAGCTTTGGGAGTGCCCTTAGCCTTGACGGCCGTTATCTCAGAGC
GCACCGACGTCCTGGGACTTTGATCACCGTGATCACTAGCGAGCGACAGCACGCTGTCGTCTTTGTGCTCGCTGGGCACTGGGATGTGCCCTCCCGTAGA
GCCCACAGGAGCATCGTGCGTGCATCCAGACTCGGCTTCGTCCTCACTGCTGAGTCGAACTGACGTTCAGCGAACCGAGGGTTCGGACGGTTGTCTGGGG
AGGCCGAGGGCGACGGACTGCGGCGCTTGCTCGTTCTCTTGGCCACAGCCGCGTCACCCGTTGAGCCGATCTCTTCGGAGGCCACCTTAGTAGCCTCCTG
GAGTGCCAAGCTTTTGCCGTGAGAATTAGTGCTCTTGGCTTGCGCCTTTCCGGCAGCAGCCCTGGAGCGTGTCTTCGCACCGCTCTTCGCAGTGCCACGA
GTCATGACAAACAGTCGAAGCGGAGACCAAGAAGAGGAGCGCACAGACTGCTGCTCGAGGCTTTAACTGTGAAGTGAGCCTCAGCCGCGCTCGCGCTGCC
AAGTCGATGTTTTTCGACTTTGAGAATGAATAAAATTTTGTGACGTACACTTCTTCATTCTGATTGGTCGGTAAACCGAGCCTAAGTGGTAACGGGGTAC
GTAGCCCTAAGTGTACCCCTAGTTACATGAAGTGTGACACGTCATACTTCGGGATGTTTGGTACAAAGT