Description :
From Genome Similarity Track
Location :
Scaffold_20:37870- 46635
Transcript NameFunction/comments
Phyci_91460phosphatidylinositol kinase (PIK-L4)
Phyci_217729conserved hypothetical protein
Phyci_78833hypothetical protein THAOC_36003

Sequence
8765 bases(100 bases per row)
CCGGGTGGCTCACGCTTAGCAAATACTCGTAGTATTTAGCCAGGAAAAAATACCCTTTCTCCCACGTTGGATCAAAGTGAATGACAGCTTGATACCGCTC
GATCACCTTCCTACCCTGACGCTGACCAGACTCCTTCATCCAGTTAGTCGCCAAAAGTAAGTTCTTAGCACAAAAATGTGGGTCTTCAACGTCAAAATCC
AACGTATTTGCGTCGATGTCCATCGGCTCCAGAATTTGCAGGGCCTCGTGCATCCGGTCTTGGCTGACCAGTAGCTTAGCCTTCTCTATCGTCGCGTATT
GGTTATTTAATGCTTCAGCGTGCATCACCGCACTGGTAGCTGTACGAATGAATCCCTCTTTTCTGGCTAATTTCGCATAAAGTAGCCAGTTTTCGGACAC
TTCACTGCGAAGCCCTGCTTCATGCAAAAGTACTCGACGTAATGCGAGTATAGGATCACGGTACTTGAGGGACGTCGCAATTGCATCGTAGCGCATTTTC
CATGGGGTTTGTTTTTTCCACAAAAGACTCCGTCGATCCAGGTCATCACATTCTTTCGTTTTCTGAAGAAATATGAACCCCTGCTCTGCCTCATGCAGAA
AGTGAAGATCGTGCAGAAGTGGGTAAGCACGCTGGTACGATTCAGCAGATGCCGCAGCGAGAGGGCCCATTACTTCAAGACGTGCTGCCTTCAGGTGGCG
CTGAAACTCTTCTTGTTGCCCACCATGTAAACTGTGGAGCACACGAACCAACATTAACTGTGAGACGTCAAACCCCTTCAACCGAGTACTAGCTGTCCCA
TCAGAAGAACTGCTTGATGAGTGAAGGAGGGGGTTCTGCTTTTCGGCACTCAGCAAGTCGGTTAGCAGCTCCCAACGTGATAGTCGCCAAGAGCATTCAA
GTGCAAAAGGATACAGTGTAGCCATAAATTGCGGTTCTTGCGTCACGATGCCGTTAATATGTTGCAATGCACTTTCAAGTCGCCCCAGCTGAATTAAGCA
GCTAATCATTCCAGAATACAACTCGGGTTTGATCAAGTCAGGATCTTTGTGAGCGTCCTCCGCATCCAAAATTTGAGCTGGAGGCTGCATCATTTGAAGT
TGGCTGTAGTGTGCTCGGCTTGGTGGTAACGATCGGGAGGATAAAGCCGACTGAATTTCTTGTATTGCTTGTTCATAGCAAGCTAAAGCGTCTTCCCATT
GGGCAAGCTGTTCATGGTCAACAATCTGATGCATCAAGTCCGAGAGGTCCAAGCCCTCTTCCTGAGCCTCACCCGGAAGATCGGCAGTATCGTGCCGATA
GGTATCATACAACCGCCGCAGCGTTGCCAAACCGACAAGCGCGTCAGGTTCATCTACGCTCTTGTACAACTGCTGGAGATAAAATGCATTTTTGGAGATC
AGTGACAGGTGAATTGGCCCCACCATGGTAACGTTGGCGTCCCTTGCTTCGGTCGGAGTAAACTCCTGCTGTCGTAGATAGACTTCAAAGTATTGGATCG
CTCGGGCATACGCTCTGATTTGATATGCCGCGTTCGAAAGTGAGCGACTAGGAATTCCTTTAATAAACTCTTCCAAATAATCTTTTTCATGGTCATCAAT
CTCAGAGGGCATCTCACTTCGTGCAGATGCAGACGTTTGGCGGCTGGCAGCACTAGCACTAAGTGCGAGGCGTTTTTTCTCGCTAGTCCAGATCCATTCG
TTCAGCTCATCGATCGTCGAAAAAATTGTTTGGGAGCATTGGTCATGACGGCGGAAATATTCACCAACGGCCTTTTCAGGTGTAATACTCGCGCTGTTCA
CAGAGTCATTAGTTTGTTCCGAATCAGGTGGCGCCATCAGGACATCATCCATCAAAACACCGCAGTCCTGGCCATCCAATACCGCCATAACTTCCTTCTT
GAGCTCCTCTCCAACTTCGGATCTTCCAGATCGAAGCACGTTCTGTATCAGATATGGCAACAAAAATCGAGAAATTTGAGGGCACGTCGCTAGCGCAGTT
CTGCATGCCCAGAAAATCTTTCGCTCCGGAGGCTGGGAAAGATGAATTAATCGCCGGCACCACATCAATAGCCATTCTTCGTATGAGGTACCGTACTGTT
CATAAAACGAAATGTCATCATGCGCAATCTGCAGGCTTCGATCCGCGCTCGCAGATGACCGGCGTTCAGACCCGCTGCTTCCATTGCGTCGAGAAGAACG
CCCACCTGAAACAGTGTAGTTTGTTGACCAATATGGCTCAACAAACTGAAGGACATCTTTCCGTTCGAATCTTCTTTTCATCCATTCGGGCATGGGAGCG
CTGGAATCCTGCCTTGACTTGTAGGACGAGCCATAGGTATTTGTCGACGCCAAGCTTTGACCGCTGTGTTGTGGATCCGCCGTCATCTCTGCCAGGAATT
TTAAAAGCTCTTGGATAGCAAATGCTAACGAGTCCGTATTTTCGGGCGCCGCACGCAGTTCTTTCACCAGCCATGTTTCAATAAGTGCGCAGGCTAAATC
CTTTGTCGTGTACTCGCCTTTTTGATTTTGTTTCTCTTTTGCAACTGTAGCACCACCTTGGGTCCCACCAGCCGTGTAAAACATGTATAATGGGACGCGA
GCACTATCAATTGCCCCCAAGGCCCCCAAACACCGAGCGCAGAGTAATTTAATCGCTTCGTGGCTCTCCGCGCGAGAAAGTTGCAGAATCGACTGCACCA
CGCTCGCCAGTGCTCGATCAATAAATATGTCGCCTTCGTTCTGCATCAATGCCTCCAACTCAGTGCCACGGACCACCAGACAACGTAACAACTGAGTGAG
TGCCATTTCACGAACGGCCACATCAAGATGGTTTACATATGAGGATAAGTTCATTAAGTACTCGCGCAAAGGCCGACACCTTGGGTCTCCGTCTTCTTCG
TACAGAACAGCGTATATCTCATCAAGCTCTGGAATCGAAGGCAGCAACGGGATTTTTGGAAACGCTGGCTTTAACTCAGCTCTCCTTTCAATGAACAAAT
ACCGCAGAATACCCACTGCTGCCGTCATACATCGCGTTTGAACTTCGTTACGATCGCTTGAAGACTGAATGTGAGCTGTACTATCGTACTTTAAGAGCTC
GAGAGACTCCACGTTCCAGCACTGACAACCGGTGATCGAACTGTCTTCGATCAAAATTGCAGAGGCTTCATGGCCGAGACATGGGAGAAAGCTGACAATA
ATTGAACTTAGGTTCACCTCGAGAGCTTTAGTTGAGAGCATTCGCAGGAAGTTTCCCCAAGCTTGTAGTGCATGTTCGTTCAGTTCACGTTCCGTGAGAC
CGACCTTCAGTGTTGCCATTACTTTTGGAACAAAAATATCGACAACACCATTGCTTTGAGTGCTGCCTGAGTCCAGAGATGAATTGCTGTAGAGTTCCAA
CAACCTATCGATGCTTTTGATCGCACGAATTTTAGTGGCAATCGGATTTTTACCGCTTATTCGATTGCCAAGATCAGTCATCAGCGCCAAGAAATACTGG
CGAGGCATGCAACCCTCCCCAGGTTGTAGGCTTGCCACTTGCTCGATCGCTTCCGCCTCCCGCGTATCTTCGCTCAAGCAATTTGCGACCTCTCGTATCG
CTCTCTTCGCCATTCGAGATTGAGGTCCACCCAGCTCCCACGCCAGTAAATTCATTAGCCGCAGTGGAGAGTGCGTAATCACATCACGCACAGTTAAGTT
CTCTGGTAAGAATTTGAACAAAAACTCCCACTCTGCCAGACGGTTTTTATTCGAGACTGTTTGGACTTGATGAATGAGCAGGTCTTTCAACACGTAGTCA
AGATGATTCAAGAGAAGATTAGTGATAGTCATCGGTGGATCACCTTCTGCACCATTATCGGCCATAATTGCGTCTTCCCCGGTACCATTGTACTCGTCGA
CGTACGCATGCAACATCCGCTCGTTTTGATTCACAACATATTTCGGAAGAACGTATGGCGCGCTTGCTCGCAAGAAAACTTTGATGTCAACTTTTCCACC
CATAAAGGTACGAAGGAACAACTGAAGCGTTTGAGTTTCCAGCAATTCGTCGACTAGAGAGAAATAGAGCAACTCCGGAAAATCGACGCATAAACGTCTC
CATGACACATTGTGATGGACAGTGATGTGGCAGATTTGGTCATGAGCCATAGCTGCACATCGTAAACGTTTTGCATTGTGAAAACGGTTCCACATAGATA
CTAGCCGTAGCAAAATCCACATGCAATTATCCCCACGATCGCCTTGTTGTGGGTCGCATTCACAACCAACGGCACCCGAAGTCAGCATAATCGCCGCGAT
GAAATTTTCATCAGTGCTTTCTTCGGCAGCCGTCATAAGAGCCTCTAACCGCTCCATTAATCCAGCAAGACCATCCCTAGCCGGGTCAATCATTGCATCA
AGAAGGCGGGGGTGATGAACTATCGATCCTAGTACTGCTTGGCGAACGAGCCCAGAGCGATGCTCAAAACATGTCAAAAGATAGTCCACAAATCGCACAG
CAGTCTGATCGTTCCCGTAGTCGAGTTCACAATGCTCAAATACGCTCGACAGCGCGTTTATTTTGACGATCTGCATATCCTCGGAAGCGCCACCAGTCTC
ATCGCAAAGTATGGGCTCGAATAGAGCGAGAGGAATTGGCACAGCTTGGAAGCTGCTGACAAGATCTCGACATTGGCAACTGCTGGAGCGGCAACGGGCA
GCGCTATCTTTTCTTTCGAGCGGGTTACTTATTCCATCCGCTAGGGCCTGACCGTACGCTGTTGCGCAGAGCATTGCTCCACACGCTTGTATAATACTTG
ACGAGATCAACCTGGACCTCGTACGCTGAATTTTCGCGCACATAGCCTCCATAACACACGTAGCCATCTTTTTGGGGGACGTTATAGATCCAGCTACGAC
AAAGAACGCCAGTAAAGGGGCCATGGCAAGATAGGAACAGACTGCTGCATCGAGCGATGTCTCTTGCAGGATGCCCTGGTAAGCAATTCTCCAGGGAAGA
GCATTCCGCCAAGCATCCTCATCACTCAGATTGAGTATCACAGGTCGTGACCACACGAAGTAGACCAAGAATGGCCCGCGTAAAACCACAGATTTCTGAA
GAACTGCATCGAGCATCGCCTCTGAACTATGGACGAAGTCGTATGAAACTTCGACCAAGCTCTCGGACGGAGGGATGTCGTGGCATTTTGGATGAAGCTG
GTAGAGCTCTAAGAATTCCAAATATTCCCAGCAGGGGGGCGCTGCAAATGATTTGTCTCGTTCGATACTCTTTGCAAAGATCTGCTGAGTCTCGATACTC
TCAATAACTTTGATCAGTAAGACCCGATATTTTTCAAGCTCGTGATCGTCAAAATATCGAAGTAAAACAAGCCATAGATCTAAGTACTCACTCGTGATAG
AAGTGAGTGAGGGCGCGTACGTATTCAGAAGAAGATCCACACGCTGAAGAAGGGCTCGGAATATGGCAAAACTTTCCAGTCGTACAAATGCCACTATGTA
CCGACGGAGTGGCAAAATGACCCGCAAGCCTGTGGAAATTGCAACTATGCTTTTTCGATCGCTCCCGTTTCCGATCGAGATCAAATCAAGAATCCATTGG
CCAAGTTTTTCGTGCAGCTCTGCGTTGCTATCACGATGCATGCCATTAGATGGACTCTGCTTCCCCAAAGAGATCTCATTTCGCTTTCGTTTCCTTGTTG
TATTGACATATTCAGTCGACTTTGTCCTAGCGGAGCCATTAGCCACCAGCTCCTTGGATACAAAACGGATAACTCTTATCAGCACTACCTTCGTCGACAA
TACACGATGAATACCGTCAATGATGCTTGAAGTGACTGCGGGGTTCGATACTCGCACATCGACATACCCCAACAGATCCACGAATAGCGAGGCAGGAGAC
GCGGTATTGGACTGGCGAGTGTACAGGTTCAAAATCGAAAGCACGACCATCCAAATTGATTCTACGGTGCTTTTGCTTTCCCGATTAGCCCCACAAATAG
GTTGCATATTCTCACATACCCATGACTCAAAAGGTGGCCACAGCACGTCAGTGGCAAACTTGGACAATCGTGGGTACGCTGAACCAACCAGTTCAAGAAT
GGCAGCACAGGCTTTCAGTATGCGGGGGTTGTTCTCATGGACACAACTCGATTTCAAGTACATCAAAGTCAGGCGGACAAACCGTCTTTCCATAGACATG
CTCACCTGGAGCATCGTGTGAAGCAGTCGAAGCGTGCTTCGAGTAATTTCGCCCGCCCCTTGAGTCGACACGGCGCCGTTCACAAAACCTTCATCTGCGT
TCTTCACAAGAGCCTCATTCTTTACAATGAACATCTCCACCAACTGGCACAACCTGTCAAACGATGGGTCACCCTCCAGCATCGCATGATGCTCCCGAAT
AATCCGGTCCGCCAGTGCAACCACAGACTCCCGAAGCGCCACAACCATCCCATAAGAACTAACATGAATCGACGGCAGCATCTGCTTCAGCTGCTTCCTG
CGTTCGTAAAGCTGGTTCCCATCAGTAATGGGCATGCACCCGCACAGCGTGACGTTGCTCTTCGCGCCCAATGGGCCGTCCGCGTCTTGGTACACGTGTA
TCGCCGTGTCCAGGTAGCACGCAATGCTCGCCCCGCCCTGCAGCACATCGGTATCGTCTCTATTCTTCAGCGACTCCTCCAGCAGGAAGCAGTCCTCCAG
CAGCTGCACCGTGTCCCGGAACAAGTGGATGAAGCCGTACACGTCGTTGCGCTGCAGGAACAGCACCATCTGCAGCGTCACGTTGCGCACGTCTCGCTGC
GCCTGCCGCAGCCGCTCGTTGGTGTAGAACGACACCATGTAGAACAGCATCGTGGCCAGCGTCGGGTAGGACGGGAAGCCCGAGGCCGCCGCGTTCGCGT
TCTCCATGAAGAGCGTCATCGAGTGCGGGCACGCGCCGCCGCCCAGCAGCAGCGCGAGCAGCTGGCACAGATCCTGCAGCACCGGCACAGCCCTGTCGGT
CGGCAGCGTGGCCACGGGCCGCATGAGCTTGGGCAGCAGCTTGCGCAGCTTGGTCAGCATGGTCTTGCAGCGGCGGATGGCCGCCGGCGAGCTCGAGTCG
TAGGTGCGGTCGTCGTGCTGGCGCTGGTGGGCACGCACGAGGCGCAGCAGGCTGTCCACGTCGCTCTTCTCCGCCTCGTCGGGCGCTGACGTcggcgccg
gcgccggcgcgcgggTCGCCATAGTGCGGAATGCGGAATGCGGAATGCAGGTCGCAGGACGACGGACTTCAACGTACTTAAGTGAGGTTGGTGTGGCACA
CATAAGTTGCAGGCAATGTCCGCTTAAGTGCGGTCCCCCAGGCCAAGCGATTCGTCCGCGCCACTCCGACCGCACGCTCAATAGGCTCAAGAATGGCGAC
CAAGGGCGTGTGGCAGCTCAAGCAGGTGACGATCCGCTACTGCCAGCACAGCGGCAGCAGTCGCTACGTGCGCCAGCTGCTGGGTGACGAGCGCTTCCTC
CAGTTCGTGGAGGAGAACCCGCAGGTGCAGTTCGAGACGGAGCTCAAGGGCGCGCGCCACCCCGTGCTCATCGGCGACTACGGTGCGTGCAGCAATTCTA
TACGACGGTGTTTGCTGTGGAATGGACGGCAATTAGGTGCTAATTAGTGGGGCGAGGTGGTGCTGTGCGTTGCAGTCACAAATGAGCAGAAGGTGTCGGA
CATCAAGAACCAGGACATCCCCTTCATTCTGAAGCAGGTGCGGATCGGATCCCGCAACTTTACTATGGGCTGCCCAATTGACACCTGTAATTTATGCTAT
TGTTGCTGACGTAAATGCTGTATTCGCCGAGCTACTTTGTTTAGCTGGAGCGTCTTCGCAACTCGAGCGGCCGCAAAATGACGCGCATCAAAAAGCCGGT
GTTCTCCAAGCGCCCGACCATCCAGGGCATCTGGCAGCCGGACCTGGACTTCCCGGAGTTCAAGATCAGTGACCGCACGTAGACGTCGACGCTGCTGGTT
CGAGGGGGTGCAAAATGCAGGTGTCCGTCGACGCTTTCCCGGCACTGTAGGATCTCAAGTTTCTACGCTGGAAAAAGTGTTCGTGGTTATTGTCAGCTCG
ATAAGAGGACGACTGAACTTGCAGTTAGCGCTACCGAGGGCTCTCTCAACTAGTGAAGCATCAAATATATTCTTTCAGCAGCTGCCGAGAAGCAGGAAGA
GAGGTCCACCACCTCATCTCCCTCGCTCTTTCCATCTAACTCTTCGGAATCACAAACCAGCGACGCTCCCCCTCGCACCGGCAGCGGCTGTGGCAGCTAC
AGCTACAAAGCTACAAGGCCCTAGAGGCTTAGAAACCGTGCAGCACCACCTGGGCGTCCGAGCAGATCTCCTGGTCCAGCAGGAACTCGCGGATGTTGGT
CCGCTGGTCGCCCGACAGCTGAATAATCTCGCCCAGCTCGTCGTCCTTGACGATGGCGCCGTTGCAGCTGAAGTTCTTCTTGAAGGCCTTGAGGATGCGC
TTCACGTCCAGGTCGTCGGCCAGGCCCTGCACCGTCGTCAGACACTTGCGGCCGTTGCGCTGCTGCACACGCACGTGCACCTTGCCGCCGCCGATGCTCG
AGTCGTCCTTGGCGTCGGCGAAGGCGTCTACGCAGCGAAAAAACGTCGCAAACATATCAGCACATCGTCCCGCATCTAGCCCACGCCCTGTCGTAATGCC
TATCGCGCTGCAGCGGCTGCAAGAACGCACCGAAGGTCTGGAAGTTCTGGATGTCGGCCATGTTC