Description :
From Genome Similarity Track
Location :
Scaffold_1148:3787- 7535
Transcript NameFunction/comments
Phypl_g12561transient receptor potential Ca2 channel (TRP-CC) family protein
Phypl_g12562conserved hypothetical protein

Sequence
3748 bases(100 bases per row)
GGGAGGCTCTGTGGAAAAGATCGgtgtgttgaagttgtctCGGTGGTCGATGTCGTCCCGTTTTTGTTTGCGTCCGTCTACATGTCCtccgagatggcta
cacctTCCATTTGAACGTGGCAGCAAAAATACAACACACAACACACAagaacaccagcaccagctccatccCAACATGCAGCACAGACACCCGAGCGGAG
TTTGCAGCTACACCATACACTGAGTTTGTACGTCGAGCCACCGTCGCAGCGGCCACATGGCAGACTTCAACTGGGCGGCTTCGAGAGCTTGTTCTAAGCG
TCCGCGGCACCCAATCAATGGCGAGTTAGCGCACCATGGCACAGCCAGCCGCCTCGGACTCGCAACTACGAAATAATTTGCACTTATTCACTCACTCAAA
CCTACAGCATGTGCTTCGTGGGAACACGCGTGCCATTTGGGTTCTCGGTGAGttctccgccagcagcacgaggagcgGCAGTCGCAACACCAGCAGTAGT
GCGCAGCCCCAGCACAATTCTAGAGGAGATGTCTTAGCGCCGTCGTATATAGCGGGGGTTAACCCACCAAATGTGACAAAGCTTGCTGGTTAGCCGCTTG
GTGAGCTCCTCCCGCCGTGGCTGCCTACCGACTGCTactggagctgccgaagTCATGTGTACCAGGCTTGTGAgccgaccacgacgccaacTACGACTCT
CAGCTCCGTCATAACTCAATTGGGCTCCACCCCACTCAAGCCACCGCGACAGTCAATCCCACCTCGCCAACAACCCCACGAACAACAACCAACCACTTGA
CCAACAACCATTCGAGCAACAGGAGCACGAACATGGATACATCCAATGCGAAGACCAACACCACTAGCGACGCGGCCTTCGCCACCGTGCCTCGCTTCGT
GCGCTCCGTCTACGACATGCTGCAGAACGAAGACCAGCGCATCCTGTCGTGGTCGGCCGACGGGACGCACTTCCAGGTCTACGACGTGCCGCGACTGGAG
ACCGAGGTGCTGAGCAAGTACTTCAAGCACGGCAAGTTctccagcttccagcgccagctcaacAACTTCGGCTTCCACAAGTGGACCAAGACGCGCGCCA
GTGTCGCCACGTTCAGTCATGACGTGCTCGTGCGGTGTCCCGGGTCTGAGCTCCTCGCCTTGGTGGGCCagatgaagccgaagcagaagtcgACCGCGAC
AGCGGCCACGCCTATGAACCCAACAGCGTCGAACAAGCGGCCTCGGAGTTTACTGTCCAGCACGATCGACACCGAGTACACGGCCGTtgtgaagaagcac
aagatgTCCCCGCGCGATGTgtgcgccgtcgacgacctgTCGGACGTCAGCTTCGCGTCGATCCTGGAACCGCTGTgggtgctggaggacgtcaGCTACg
gcagcaaggacgacgtgctggtgcttgaTGAATTTGACTGCGtcgatctgctggcgctggactgGGACGCCGTCGTCTCGTCACTTGAGACGCCCGACTG
CCACAACAACCGCAACAGTAACAGTGACTGCATCAGTGACATCGACTTAGACACCGACTTGGACTtcggcttcgagctcgactgCGTGGCATCGTCTGAT
TTGCTGACCGAAGCTGACGTGTCTGCCGTCTTCGGTGGCCTGGAGACCGCTCAAGTTTTGTCGGACTGCGAGCTGGACGCTCTGCTCGGAGACGCCTCCG
ACGTGGACGCCTTGTTTTTCGTGTAACTCGTATGGGCGTAATTTGTACCTATCGACATATGCAGTGCTGTAGTAACGGTAAACGTCGAGCATCAAATTAA
TTGAAGTGCCACGCTTTTGATGTACTTCGTCAACAACAATTCGTTGTATTCGTTGAGAAGTCGGGTGACAATGCGCTCTATGCCTTTTTAACAAGCCACA
CTGGCTCTGCAATCGTATTTTTGCATGCTGTGGATACTACGACCGCGACTAATGGTTGTTGCTGCCCTTGGTTTTTCAGCAACGAACATCTTCATCGATC
CACAAATCACTAATGCCGGCACACAAAACCTGCAAGTGGTTTAATAGTCGAGATCGTCCCGCTCAGTGTAGTCGTCCTCGGAATTCTGCCAACGGCGCCT
CGCCCCGATCTATCAAAACGTAAAGACATACACGTGCCCTCTGAATCATATCTGAAAATACAACAAAACTACCGTGGAAGCACGTACCTCGTCAAGGTCC
TCACTGTCCGCCTGAGACTCGTCCGATGACTCTTCGTCAGGATAGTCGTTTGCCACGTTGTCCTCATCGTTGGAATCCTCGCTCAATCTACAGACCATGC
ATAGCCACGGACAAGAGAAAGCGTCAAAACAAACCCAGCAGAGGCCGCCATCGTCAGCAACCCGCCGCCTCTCAGCATTATGATCTTTAGACCGGTCCCG
ATCGCGTCCACGTGCCCTCGTCACGCGCGCTTCAGCGGTTCCATGGATATCTATGCAGGCATGCGTACCCGTCAACTTCTTCGTTGCTATCGATATCGGA
CTCCAGCATATATTCCTCCACCGTGTCGCTCGGCATGTCTTCCGACAACCACCGGTGCACCTCCGAGCTCACACTCACGATCGGCACACCGTTCACGCTT
GTTTGTTCAGAATCATCTTTAGAGGTGGTAGCTGTGTCCTGTGGGCTGTCCTGCCCCTCACTTGCAGAGATGTCAACGCAGTAAACATCGTAGACGTAGT
CCTTCTCGTGCTCCGCTTCTTCACATGCCAGTAGTGCTGTCTCTACATTGGCATGGCCCCCCCGCTTTGCAAACACAGCTGCCGTAGCTTCTTCCCAATC
TTGTTGAAGAACACTAGTCGTGCCAGAGCGCAGTAGCACTTCAATCACATCACTACGCCCATGCAGTCCAGCAGCCATGAGAATGGTTCTCCCATCCGCT
GGTCGTTGAAACGTCGTCGGATCCGCACGAAGCTCTGGCCGCCGCGCGTGGACAATCTGGAAAAATGGGGCGAAATCGTTGGCACGGAACGCAGTCCAAA
TTGCTTCatccagctcgcgctcgtgcggGTTCAACACCCTTGTAGGTTTCAGCCTAGCTCCATTGACCGTGACGACATCagccttgctcttctccaaAAT
CTCCGCATCCGTCCTCTCCTTTGCCTTCTCTGtactcggagctgctgacacCTGCAGGTCTACCAGCCGGATgccgtgcagctccatcgtctGCGTCTCC
TTGATCTCCACGATGGGCTGCAGTCCTCTGGACTTGAGCGCCTCCTCTTTCCGCCGCGCTTTGGAGcgattctgctgctgtttgacGCGCTTCTCCGTCT
GCTTGGAGGCCGTGGGGTCGCTCTGGAAGACCGGGGTGatgtgcttcttggccatcatgtcggcgtgctcgtccttgagcgagcgcgccttgcgcttgag
ccGCTCCGTCCACTTGACGCGGCCCGGGGCGATGGGCTGCTCCATCGTGTCGATGTGCTTGAACACGAAGCGCTTCTCGGTGGTCGACAGCTTGGTGAAG
GCCTGCAGAAGGTCCGTTGACGCCGCCTTGGAGCGCTTCGAGTCCGGCTCGCTGTGTACCACCAAACACTCCATCGGGTCGTCCgtgcgcttgcgcttca
gccGCAGGAACACGAACGACGGCTTCTCATGGGCCTCGGGCTTGGGCTTCGAcacgcgtgcagctcgggaagcgctggtggacggcaCCGTGCCGTGCGG
GCGGGCGGCGACCGTCGTCGAAGTGGGCGACGTCTTGTCCACCATTGT