Description :
From Genome Similarity Track
Location :
Scaffold_70:37862- 52477
Transcript NameFunction/comments
Phyta_totarag2846conserved hypothetical protein
Phyta_totarag2847hypothetical protein
Phyta_totarag2848conserved hypothetical protein
Phyta_totarag2849conserved hypothetical protein

Sequence
14615 bases(100 bases per row)
gttgaaggtgtcgacgctAAAGTGCCGCCCCCAGCTGATTTAGAAATATCCTACAGTAAGGTTGTCCTTCGAGCgtaggtacatgtacatgtaccgtatt
CCAATCTGCTGGGAccatgaaggagaagcaagGTCGACCAGCTGACAGCGCACTCACGCCCGGCTGTCATGGCCGAGACAGCCCCAGCGCATTGTTCGGC
GCTTGTCCCACAGTTGCTAGCGTCAGCAACGCAGAGTCGATGTGGCGCGTGACGGCAGATGGGGAGCCACGTTGAATCAAAGAGATGTGGCAGCCAGCAA
GACCAAGTCTCACTCTCCACTCTCGACTTGGCGAGGTCACCCGACCACTAGGCAATCTACCGGCAAAGAGACGTCGCGATGACTACCAGTAGACAGGGCT
CGTGTTCGGACTCGAATTCCTCCGGCCGGTATGATACGCTTGAAACTGACCCCCCCCACTAGTCAATCTTTCGTGTCCTACTCACTAACTAACAACATCC
GCCTTCTCGTTACGCTTCTCCTCATTCCAGAGACCCCAGCGACAACATGCACGACAACGGCGGCCACTTCCCGCTGCCGGACGACTATTTCCCGGAGATC
CACCTCACGTCCAAGGAGGTCAAGAACTACGAGTCGCAGATGCAGGAGATCGTCAAGAACGCGTTGGCAGAGTacgagctgcacgaggctAAAGGGATGT
ACCCCGTCTACCGCGCGCCGTGGAGTCTCGTGAGCAAGGTGGAAGGTCTCACGACTATCAAGAAGGAGACACCCGACAGCCCCACAGCCAGCCAGGCACG
CATCTTCGGCCACATCAACGGCGACTACCGCAACTTCATCGACTTCTTCTACGCCGAGACGTCGGCCGAGCTATTCGCGTGGAACCAGTTCATGTTCGGA
TACGCCACGGACGCGGCTGTGCTCAAGAACATCCACACAGTggcgtccaagaagaagtgtCTGTACATGGGCATCAAGTGGACGTGTCTGAGTCCGTCAC
CGCTCGTCAAGAAGCGCGACAACTGCTACATGGAGTACATGATCTACACGAAGGACCTGCGTGGTCGCGACGTGGGCGTCCGCGTGACGCTCCCGCTCGA
CATCCCCGAGTGCCCCGAGCTGCCGAAGAAACTCAAGACGAAGCGGATCCGACTGAACACGGTCTGGATCTCAAGACCTGCGGACCGCGAGCCCAACGTC
ACCGAGTTCTTCATGCTGTCGCAGAACAATTTCAACGGTCTGGCGGTCACCGCCAACTACTACAAGCGCATGATGAACATTCTCATGAACATGGCGGTCT
TCGTGGACTCGCGACGCATTCTGATGCAGGGGGTAATGGCACGGAAGAGCTGGGCCAAGTCGCGCTCGCgcaaaagctgcagcgtaTGCTCGCGCAAGTT
CGGACCgactcgccgtcgccaccactgcAGACTGTGCGGAGACCTCATTTGCCGGCGGTGTGCCATCGTTCGTGATGCTCCCAAGGATGAAGGTCCAGGC
AGCGTGGCAGGGTCAAACAGGACGTTCGAGATCGTCAAGACGAAGTTTTGCGTGCTGTGTGTGACGAAGATGCGCGAATCTCGTAACaatgtgctggtgc
cggtACCTGCTCCGAGCGGCAAGCTATCTGTTGTGGACTGCGTGGATGTGGACCTCGGCGACTTCCGTAACTCGACCATCTCCGAGACTGAATCCGAGGG
CGGCCAcatttccttcttctccgagaCGGGGAGCAGTGAAGGAGCCCGATCGCTGCAGTTATCGCCACAGTCAACTTCGATCTCCTCAAGTATTGGCAAG
ATGTCGTTTGTGTCTAGGTTGGGTGTGATTGATGACCAGTCCGTGACGATCCTGGCGGACCCCAGAATGACCGCCAACGAGCTGATCGAAGAGGAAGTGG
CGGAGGTTATTGACACGACGGATATGATGCCGGTGTCGTCGCTCAACTCTTCAAAGCGAAGTGGGAGCCCTCCGAACCAAGAGGCGGACAATGACTACGG
CAAGACGAGTTCAGGCAGCGGCTCCAGTTGGTCTCCGCTCGGTTCCAAGACGTCACCACGGTCCCTCGACCAATGTCTCGCAGAGCAGGAGGAGTTGCTG
CGACGCATGATGCTTTCGGCCAGCGGTGTGCGCCGCCAGAACACTGCGAACCCAGGAAGCGGGAGCTTGGGTAGCAGCGGATGCGGTTTCTCCGGTGGAG
TTCAGTCCACCAGGACACGCCCGGATGTTACACTCTATGAGGGCTAGCCCTGTCTGCAAGAGCATTACTAGTATTAACCTAAGCGTAAGTAAAAAGTTGT
TGGAATGCGTTCTCCAAGCCGTGTTGGTCCCACTCGACACATCAACCTTGGTGTTCATGATCAAGTTCGAGATTGGGTGCCAGAATCGCTGCAATTACGT
CCGGCTCGGAGCCGAGAAGCTGGCCGCGGCGGAGGAATGCCTGACCTCAAGATCAGGGCTCAATCTTCCGCCTTCAAAGCCCTCACTGGCGATCCCGACT
GCCTTGAGCCACGTGGTGGCTGCTTGGCTTCATGACAGCCCTTCACTGTCGTTCGTGGCGCGATTTCTCTGGCGTGTCCACATTGCGAGAACTTCTCAGC
CCTGGATCCTGGATGTTTTGCGGTCTTCGGTGATGCCTTCGTAAAAAGGTTGGTCGTGTTGCCGCGACAGAGAAGCCATTGCATCCTGCACTGCAGGACT
GCAGGAAGAAGGTCGGAGGCTGCAACCAAGACAAGCGATCCGATCCACAGATACACATGAACCGGCTTCCGTGAGTAGGGTTAGCCGGTTCAAGATCGCT
GATAACTGAATTTTACTCATACCCAGGAAAATCGATAACCCGATTTATAGGATACATATACTTACAAAATGTGTATATTTGGCACACAATTTACCCTCCT
TGATCTAATGAAACGTGAGATCTAATACTCCAATAATATTTATCGATTCTCACGGTATTTTGAGACGCTCGAACGGATCGAAGCTCCACGATCCTTCGAT
CAAACGagcgttgctgccgctgcctCCATCAAACAGCATACCCCGCCGCCTTCGTCGCTAATCAGCGACATGTGATCACCTTCATGCCATACAAAACACT
GCAGCTGAGCTGCTCTGTTCGACCTCCGCAACAGAATATTCAAGTCGTCATCGCGAAAAAAGCAAACCACTGCGGTGCACGACCGCCGGCGTGAGTGCCT
TGGTATCGCAGCCCTCATCGGATGGAGCTCATTTGCCCGCTGCCAGTGGCAGTACCAGCCAAGTCGGTTCAACCAACATCACATTTTTCCTCTTGTCGAG
CCGTGTGGAGTCGTATCGTTCGTTCGGTCCGCCTTCTCAAAAGTCGGCAGTGGCTTAAGCCTCCACGACAAAACAACGGAGCCAGAATCTTTCGGTTGCT
CAGCGCAATCTCAACGTCACTTGATAATCGACGCCATGCCCCGCAGGTCGTCGCCCTCCATGCCGTGCACGGCATCCGTTAGCTCCACTGCGTCAACGTA
AGTCGCCTTATCAATGGCATCTGCCAACTTTCTGAAGTTTGTAACGGCTCAACAGTTGTACGGATACCTTATTCGGTATCTTTCGACACTAATAACCTTG
CTCTGCTTGACTCCATTGCAGATACCGACCTGGCAAGCTCCAGTTCCCTCTGCCAGATGACTATTTCCCTCCTGTGAGCCTCTCACTGTCCCAAGTGCAG
GAGTACCAGGCCCAAGTGGAAGTAATGGCTACTAAGGTGCTGGAGTCCTGCAGGGACCACGAGTCTCGCGTCGCCGGCTTTGGACTAGAAGACGAAAGGC
GCTGGCAGGACGTTGCGCGCGACTCGGATCTGTCGGTCGTGCGTCGCAAGCAAGGCCCTAACACCATCACGCGCACGTTCGGCACGGTGACAGGGGATTA
CCTCCGGTTTGTggacttcttctcgtccgagACATCCGAGCAGCTATTCGCGTGGAACCAGTTTTTCTTCGGCTGTACCGTTGATGCCGTGGTGCTGTGC
AACTTGGACTTGAACAAGCCAGACAAGCAGGCGACGCTCGGTATCAAGTGGACCTGTATGCAACCTTCAATGCTCACGCGCAAGCGTGACGAGTGTTTTC
TCGAATACATTGTGTTCAGGAAGGACGACCAGGGTCGCGACGCCGCAGTGATCGTTCGTCTGCCCGTAGAGATCCCCGAGTGCCCACCACTACCACACGA
GTTGAAGACCAAGCGCGAAAAGATCACTACCGTCACGGTTGTGCGTGCGTCGGACTCCCACCCGAATGCGACTCAGGTGTTCATGCTGAGCCAGTGCGAA
AACAAGGGACTCACTGCTTCCACGAAATACTGCAAAAAACTGCTACGCGCACTGAAGGATGTATCTCTCTCGGCCGATGCCAAACGCATCGCCACTGCTA
TTAGCACACCAGGATTTGTGGAGCAGTCGCGAGTTGGAGGTGAACCTCTCGCTATGGGAGCCACCATTCGGCCTTGGGTGCCCTCGGGTATTCAACAAGG
CTGCACTAGCTGCTCTCGGCCCTTCCGAGCCGGCCACAGACGCCGACACTGCCAGATGTGCGGCGACGTGTTTTGCACCAAGTGTCTTGTTCGACGAGCC
GGCATTAGACAGGGGAAGAGCGCCTTCAGCAACTACGTCGCGATGACCAACCAACGGACATTCCGCGTGGTGCAGTCGCTGTTCTGCATGGTGTGCGTCA
CTCGCTCCCGTGAGGAGGACGCGGAAACTCTCCAGGAGCAGATCGAGGCCACTCGTCGCTCTGTGGCATCTTCCAAGTCGTCTTCTGTGCCCCGACGTTC
GTCAATGGGATCCTCCACACAGCCGGCGAGCTCTACTCCGACGTCTTCGGTGCCACGGAGCTCCCAATCCCAACAAAACGACGCACCTCGGCGCAGTGCG
ACTTGGAGTGAGGAGAACCGTGCGTCTTGGTGGTCCGAAACCGAGTCCGACACGTGCAGTTGGAAGTCTGGGTCTAGCCGCTTCAGCACAATCTCGCGCA
ActacagtggtgcccccaCCGTGCGCTCGTCGCTCAGTTCCGAGTACTCGTTGAGCAGAAACTCCTTCCTGGCTGTTCAGTCTCTGGAAACTCCCCGTGA
AGTCGATGCCGACCGGATAGAAGACCGCATCGACGAGCGCTCCAGTATCTATGAGGTGATCGACACGAAGGACATGGTGCCCGAGAAGCACCTTCGAAGC
CAGCAGTCCCCTGTTTCTGAGTCGGCGGACGTGGCagacgacgacttcttcagcGAGTTCCCCGACATCGTCCGTGCTCGGTACACATCCACGCCTGTAG
CTCCGACGATCGTGCCGCCGCGCGCAACCTCTCGACGCACACGCAGCACTGACGTGGCCGAAAACTCCACCTCTTCCAAGTCGCTGGACCAGTGCATCGC
GGAGCAGAacgagctcctgcagcaagtgctctCCGCCAGCCGCGGCTTCAACCCCGAGGTCCAGGCGCGCGCCAAAACGTCGTCCATGAGCGAGAGCATt
cacgaagacgacgacgacagccacgacgatggcgtTTATGAGCTGTAATCCCCCTCCGTCTAGTGTAGGCAGGAGGCACCCATCCATCGCGAAGCCAGCG
GTGATGGTAAACCAACCACTCAGCATGCTATGAGCAGAGTACACTCAACCTAAAATCCATAGACGTACGTATCAATGCAGAAATCCATCAGCACCTTGGT
TCAGAAGTAGACATTGCATCGGTTCAATGAATGTCCGCTTGGAGAACAGCGTACAGCCATGAAAGTCGACCCGCATGGCCATTACAGCACAGACGGCTGG
GTGTACTAACAAGCGGTGCACTGTTGTGTCCGTCATGGTATTCATAGGAGACATGCAAAGAGTGTTTTGCGATATGGTGGAGATCGCAAGGTCAAGACCG
TGGGTCTGTGCAGTTCCAACCAACGATAAGTGCCGATCTTTTGCGTGGCGAAGCGGGCATTCCGGTGAGGCATGGAGACAACTGTCATGCTTGCATTGCG
CCACGCCGGCAAAGTCGACGCCGCATCTCGCAAGATATCCATAGGGTCCAGCAACCACGACCGGAGCCTCATCCAAACGCGCGTGTGGCCCATCTGGTAT
TCGCATCACCGCCTGCGTGCAGGGCCAACTCTGCGTGAGGCGAGGCAGGGCAGCACACACATTACTCAACTTGCGCGGCGTCTGCCACGCTCGAGCCAGC
CGTACGCTAAACTTCAGTCTTCACGCattgcagcgacgtcgttgTGTGTTGGTTGTGCGACTGTAGGTCCGACatgtttgctgctcgtgccagCAAGGTG
AACTCGTACCCTCTGCCCGACGACTACTTCCCGGATGTCCAGCTATCGGCGCTCCAAATCCTCGAGCTGGAGGCGAGGATGACGCTCGCAGTGAAGAACG
CACTGGCTGACTACGATCTGCACGAAGCGATGGGCCCCTCCCCAAGCTACGGCAAAGGCTGGAAGACGTTGGGCAGCGTCGGAGACCTCACCACCGTACG
ACAGAACGGCGACGCGGCCAAGTGCCAATGCCGCATCTTCGGTCGTCTCGGTGGCGACTATCGCAACTTCCTCAACTTCTTCTACGCCGAGACTTCCAGC
CAGCTCTTCACCTGGAACCAGTTCATGTACGGCAACGCTGTCGACGCCGCCATCTTGAAAAACATCCACACGAGCTCCTCGGGCAAACCGCATCTGTACC
TAGGCATCAAATGGACGTGTCTGCAGCCATTCGCACTCGTTAAGAAGCGAGACACGTGCTTCCTCGAGTACATGGCCTTCACGAAAGACTTGCGAGGACG
TGACGTGGGTGTGCGCGTAAATATGCCGCTTACACTGCCCGAGTGTCCGCCACTACCcgagacgatgaagacgaagcggATGCAGATGCTGATCGTGTCC
ATCGTCCGCCCAACGGATGGAGATCCGTACACGACAGAGCTGTTCCTCATGAGTCAAAACAACTTTGCCGGATTTGCTGTTCCcgggttcttcttcaaga
gGCTTATGACCAAGATGAACGACATGACTATCTGGGTAGACTCGAAGCTCATCTCGGTCCACGGGATGATGAAGCGGACGTGCTGGGTGGACAAGAAGTC
GCGTTCGGAGTGCCGCTTGTGCTCGCGGGATTTCTCAGCCACACGCCGCCGGCAACACTGTCGACTGTGCGGCGAGGTGTTCTGTCGGCAATGCTTACTT
CACCGTGGCGCACGGGATGGCGATGAGGACGGCGACAGCACACAGAAGACGTTCAACGTTGTCCAAACAAAGTTCTGTCGCGTGTGTGTGGCCAAAGTGC
GGGACTTGGACGTGACGTTGCTGGCACCGGGAACACGCGGCAAGATCGAGGACAAGGCCACAACGCTTAGCATGTTCGCGGACTCCGGGGCGTCGACGAA
ACCCGACGGTGAGCACACTTCTCTTAGATCGTATGCGGACTGTGTTGATGGAGACCTGAAAGTCTTGCCTCGTTCGTCATCCGGTTCTGAACTACTTGAG
ACGATTCGGTCGTCCGGCGAACGTGATGATGATGTTGTAGATGACGATCGCagcgagctggacgaggtgagCCAGAAGCCCATGGGCGTCGACATGTCGA
ACCTCATGTCGGCGTCCCAAATGATGCGTCGGATCAACGCAGGTGCCTCCTTTGACGAAGAAAAGTCCGCCAGCTCGGGCAAGACAACATCCAGGCGGAC
GATTGACCAGCGCATTGCTGAGCAAGAGGATCTATTGAGGAGGTTGATGCTCGCAGCCCAAGACCGAACACAGCCGTAAGGCCAACCCGCACCGATCCAA
GAtcacaccagcagcggaaTTCATTGGGTTTGTCGTCGCTACGGAGCGGACGCAGCTGCAATGGATAGTCGTCACGCACGCATGCGATCGCCCATCGTGC
TTATCATCGCTCCGACGGAGAGCGCAAGTGTGCTCGGCAAGCTGCACGGCACACTTCCTCGCAGTGAACAGCATTCGGCGTAACAAAGTAATTGTTGACC
AAACCGTTGGCGTTCACGGCATGGTGGTatctgaagctgaaggtgcGACAAAGACTTCTACATTGCGCCATTTGCTTGACAGGGGTGTCCGCGCGTCGAC
CGAAGCCCATCGACGTCCTTTCTCGACTCTTTCAGTCATTCCGCCTCGCGCTCTGATGTCCTGGCCCTGACAAGCTCGATCAGTGCCGATTGAAAAGCGC
CGGGGCGGAACTCACGATCGTCACGCTGAAGAGAAGACTCCTCACACCACATCGCAGGAACGAGCATTGCAGCGGACGTGGCTTCACGCCGCCGACTTCA
AGCTCGTTCCACAATGGTGTAAACGCGAGATGTATTATTTGAAGTCGTGTTGGTGCAATCTCTTGTTGTTATGAGTTACTCGGCCACTGAAACATTGATC
CAGGACAAATGGCAATACACTTGAAAGTCCTAACACTACGTGTGATGTACGTGGCCACTCTACAATATCTGCAGGGGGCCATCGTTAGTTGGTTGTTGTG
GTTCGCTTATGCCTTGAACGTTTACTGCTGTCCGCGGGCGCTTGGTGGGTAGTATCCGGCGGAGGAGTTCGCCGCCATTACTAGACGCTTCAACAGCACT
TCCTGCTCTTGAAGGCGCTGATCGATCGACACGTTTGATCGAGCCGATCCGAATAAGGATTGCTCTGCTAGTGTACCCCCATCCAGGGGTGATTCATCCA
GCGGGGACGACACGATCTGCCGTGTAGTAGAAACGATCTGGTTCGGCTCGTCAATAATCTCGATAAcatcgtcctcatcgtcgtcgtcctcctcctccat
gagTGGCAGCTTGCCGCTCCTGTTGCTTGAAAACCCTTCCGCTGACTCACTGTCTGCATTCGACGGCGAATCCACGAGACGAACGGCCTTGAAGTCCAAA
GCTGCAAGCGACTCCCGCATCGTCcgaagttcttcttcctcagcctCTTGTACCACACGCTCTGCTCCTGCCATTGTCCGGAGATGGCGGAGGTCGATCA
TCATGGGAGCAACAGAGTCTGTGACTTCGacctcgatctcgtcgtcttgTGAAGACGACACACTGGTCTTGGTTTCGGACTGCACCTCGGAGTCGATGCT
GCTAGAAAACTTTCCTTGCGGAAGACTGCTGCTTTCAACGGGGctcgcttcatcttcagaATCCCCGATGATGCCTCTTTGCGGTGGGGCAGAGCGAGCA
GAGCTCGCATCAACAGGCGAAAGCGACGCAATCGACGATCCACCAGTCATCGCGAAGTTGCGCTCGTTGTCGAAGCTTCGGCTGCGAGACCCCTTGTCCA
TGAGCCAACTCGTGGACTCGGCATCGGACgcgccttcatcttggcTGTCGGTCGCGGCGACACTCTTGACGTCGGAGCCACGAACCTTGCCCATGCAAGC
TTTACAGAACATCGTCTTCACCACTTGGAACGTACGCGGCGTCGAAGCAGCGCTGTCATCAAGCATTGGGGCATCACGAATCGTCATGCAACGACGGCAA
GCCACCTCGCCACAGAGACGGCAGTGCTGACGGCGTCGCGTGGTTGAAAACTTGCGGTTGCACACGGTGCAGTCGGCACGCGCTTTCTTCGGTGCCCAGC
TCCGGCGATCCAGCATGCCGTGCATCGAAATGCGCTTGGAGTCGGCGAACAACGCCATGGAGCTCAATGTGgtcatgagcttcttgaacgtAGCAACGGA
TGAGGAATTCGATCCTTTGTACATGTCGATCTCACGTGTCATGAAGATCTGCGTGGTGTCGGCGTTGTCATTCGTTGGGCGGACGATCGTCACCGTGTGC
AAATGAATTCGccgcgtcttcagcttgtccgGTAGCGGCGGACACTCGTCCAGGAGCAGAGGCAGCGTGATGCGGACGCCAACGTCTCTACCCTGAAGGT
CCTTGGTGTAGACGAGATACTCGAGAAAGCACATATCGCGCTTGCGAGAGAGCGTTGCCGGCTGTAGACAAACCCACTTCATGCCCAGATACACATGGGG
CTTTTGCGATTCTTTCGTGTGGATGTTGCACAGCACCGCGCCATCCACCGCGTACCCAAACATGAACTGGTTCACCGCGAAAACTTCCTGAGCCGCGACC
GAGTAGAAGAAGTCGATGAAGTTGCGGTAGTCACCGTCGATGCGTCCGAAGATGCGCGAGGACTCGACTGCCCTGGACGGGTCCACCTCGCGAATTGCAG
TCAGGTGCTCAACGTTCCCCACGTCGGTCCACCGAGATCCATAGTCCGGTCGGGCGCCCATGGCCTCGTGCAGGTTGTACTCGGCCAGTGCGTTCTTCAT
GATGatctccacgcgctgctcgtAGACCTCAATCTCGGCCGGGGTGAGCTTCACCGGCGGGAAGTATCCATCTGGCAGTGGGAACTTGACGTTGCTGGCG
TTCATTTTAGGTGTTGCGCCGCTGCTCGCCATCAATTAGGAGGACGCAGCACACACGCGCAAGCTACACTAGCACTGTATAGTGTTCGGTGGGGGTGTTT
CtgagcgacgacgctccTAGCACCAAACGCTCCTTTTGCAGTGTGTCAGTCCGTCAGATCTCTGGCAACGCTCGTGCCGAGCGCTGTGCGCGGTTGTGGC
TGGCCCGTCCACCGTGTGCAATGCACTGCAATGCTGCAACACTGCaatgctgtcgtcgtccttgcaACGTGCACTTGCCATTGCCTGTGCCTTTCGCCGC
GAGTCTCCTCTATGCATGAGGTGGGGGAGAACAGACATCCGATTTCGTGGCGCCGAGGAAAGAGAGATGAGATTTGAGAACGCGGCCGAAGCGCTGATCG
ACCGGGATTCCGTCGCGGTGCAGACCTTATTAGTCGCGCGTGGAGTTCGGCATCGGTCTACAGGATTCCGTCCAGAGAACTGGTCCTCCTCTGCGGTGTA
TGCGGCGGCAGGACTTATTAATATAGTTGTAGCCTACAATAGTCATTCACGCATCTCTGACAATAGGAAGTGTAATGAGAGCAATGCCCTGCATGGGtat
cgtacatgtatcatacACGTTATTCTCGGATCAGTACTGTGTTCATGAGCACTATTTACAAGGAGGTCCCACTGGTAGTCAACCGCTCGCCGAGCGATAC
CACCGAGCGCCGCTTGGTGGTATTTCTCGGGGTGGCGGCTTCAACGTCGCTGTTAAATGCTTCACAAACCATACGGCGTAGTGGCCATCGTGGTGCTTGG
CCTGCACAAGCCGTATGGACCATACTATGGAGGCCCACCATGGGTGGGGCATctcggtgttgctgctgcggtctCATGTGCGCTCGAAAGTTTTGTATCA
AAACTGGCACTTGCTGAAGACTCCAGTTTTGACTCAAAACTGGCACTTGCAGAAGTGCCCCACGCACTCATCTGCGGCTTGCCATGGCAAAGCGATGCCg
cgctgtacatgtacatgtactgtacccCCTCAAGGTTGCTCAAGCTGGGTGCTGAGGCCGATGAGTCTCATCATGGCACTTGCCGACGACATCAGAAGCT
GACCTTGCCGGACTTCGACGAGACCGCCCGGAGGGATTGAGGCTCGTTCATCGAGCTCGTGCGCGGTGCTTTGAAAGCTTTCGCAAGTACTGTTTGGCGG
GCCATAGGATAGTGtacctcctcttcgtcatctaGAGTCGCACATCTCCTTGTCTGGATTGCGGTCGGTCTCCGATGTGATGCCTGTCGTCTTGAGCAAG
CGAGTTGAGGTGTTGCTAACCTCCGTAGGTTCTTGTTCATGTACTGCAGCGAGCGACTCACCTCTCCGAGTCGGACATTGCACACAGTGCATTCTTTTAC
GGGGGTGAGCGAGACTCGTGGCGGTGCTTTGCTTCGACCACAAACGCTGGCACAAACACAGTCCACCCCAGACTGTATCACGGTGCCGAATGCTTATTAT
TTTTTCGCCGTAGTGGGACCCCGGACAAACGCCGCGCCGCCACGAACCATTGCCGACCGTCTCTATACAATGCACGAGCGTCGACTAGCAGAGGTCACGA
AAAAATCGTGATCGCCGCCAGCTTGTTGATGCACGGATTGCGGAGACTCGCGATGGCTGAGCCGAGCGTCATTGCGGTCCAATGTGCCTGGCGTGCTCGA
AGAGCTCTATCCTCACCAACGCACGAAGCTGGCACGTGGTGGTCTGGCAAAGTATTTACATGACGGGTCGAATACACATTGTATCGACGTCTATTGTATA
GCTGGCTCGGCAAACTGATGGCTGCGCAGTGAGCCATCCACTTTTTCGAGTTCCCTGCTCCGGCTACGCTCTGGATGTAAGTCACATATGTTGCTGCGAC
TCTTCTGAAACACATCGCCGGCCAATGTCCCCAGCTGGACCTACACGCATCTGTCTCTCGGTGAAGTGGCCGCTCGAGtgggcagcagctctcgaacGGG
ATCTCGAAAGCCTTGGGCGCAATCGCTGGGGATTAGTTTAGTTCTCGATTTTCCGCCATGCTGTCTTCGAGGCGTGGGCGCACCTTATCTCGGTAGGTTG
TCATGAACGCTGACTCAGAATCGGCCACGGTCTCCGATAACTAACGCACGATTTCGCTTGTCCACGGTATCACTTCAATCCATGTCAACAGGAATGACAC
GAAGACGTTCCCTTTGGCCGACGACTTCTTTCCGGAGATCAAGCTCACGGACGAACAGATCCGGAGCTATGAGGTGCAGGTCGAGAAAATCATCCGAAAC
GCGTTGGCCGAATACGAGCGGCACGAAGCAAAAGGGGCCTACCCGATCTACAGCGCACCATGGGTACCCGTCGGCACTGAAGGCCCCTTGACCGCCATCC
GAAAGGAAGCACCCGTGGGGCTCTCGCACAGCGAGTTCCGTCTCTACGGACGTATTCATGGCAACTACCGGAATTTCATGGATTTCTACTACGCCGAGAC
GTCGCAGGAGTTCTTCGAGTGGAACCAGTTCATGTACGGCTACGCAGTTGACGCGGTCGTGCTAAAGAACATCCACACGAAAAGCTCTGGAAAGGCACAC
GAGTACATGGGCATCAAGTGGACATGCCTTCAACCTTCGTCTTTCGGCCGCAAGCGCGACAATTGCTTTCTGGAGTACCTGACGTACACCAAGGACGAGC
TCGGCCGCAACGTGGGCGTTCGTGTGACCCTACCGCTGGAAATCGACGAATGTCCCGATCTGTACCGCGCTTTGAAAATAAGGCGCGTCAAGACACATAA
CGTCTCCATTGTCCGTCCCGCCGGTTCCTCTTCAGACGCGACACAGCTCTTCATCATGAGCAAAAATGACTTCGCCGGCCTGTCAGTGAGTGCCAAGAAC
TTCAAAAAGTTCATGCGCATTTACAACGACATGTCCCTCTTTGTGGACTCGAAACACATTTTGAAGCAGGGGATCATGTGCAAGACGAAATGGGTGACCA
ACGACTCGCGCAAGGCTTGTACGAGTTGCCAACTCCCGTTCAACGCTGCAACTCGCCGCCGGTATCACTGCCGGCTGTGCGGAGACATTTTTTGCAACCA
CTGTGTGATCGTTCGCAACGTGCCGCGTGACTCCAGCGCAAATAACAAGTCACGCGTCTTTCAGGTGGCCAAGACGCACTTCTGCACAGCGTGTGTGTCA
ACAGTGCGCAGGGGAAGCGAAGCTTCACATACGAGTGCGTCGGGACTAGCGcgtgcttcttcctccacgcATGTCAGCAGTGTTGGGAAGCTTAGCTCCG
AGGGTAAAGACCGCAAGTTGCGTAAAGCGACGAGCAATACTATCGAGCAGAGCAGCTCACGGCCAGAGTGGTGGGATGAAGTTGTGTCTCAACGGTCCGA
GTCCGATTGGTCCGAGACGGACTCGGAGGATGCCAGCAAGGCGTCGCTCAACGCCTCAGGTCGATCGAGACTTGCTAGCTCCCTGTCCTCGTCCCAGTCA
TCCTGGACCTCTCGTGTCGATACCAACCTGGACAAAGACGACATGTCGTTCGTGGCCACGCTGGAtgtcatcgacgacgacgtggcaaTACTCGATGATA
AGCCACGCGGgtccaagtcgaagctgcacaagaagctTTCGATGTCCGGCCGATACTCGATGAGTCGACGGCATTCACGTAAACAGCAGACGAAGCCCCA
GCTGTCGGCCGACACGCAGGAAGTCACCGAAGTCATCGACACGACGGACATGATGCCAATGTCGGAGCTTCGGCGACAGTCGCGCGCAGGCACCGTCGGA
GTTGTGCTCCCCGCTGTCTCTCGAAAGTACAGCAAGAGACGCAGTGGACGGGAATCACTGCTTAGCTCGAGTGGTCCTAACCGACGCCTGAGCCGTGACG
AGCCTACAAATCGATTCCGCTCGTCTCGCTCCATTAGTCAATGCCTCgcggagcaggaagagctctTACGATGCATGCTTAGCGTCAGTCGAGTACATTC
GAACCCCGGCGTGGGGTCCAAGAGAAGAGTGACGAAGCCAGCGAAGGTGGACTTTGCGGCGACGATGCCCGCACCACGCCCCACCGTTCGGCTCTATGAG
ATTTAATATCGACACGAGTCTGCAAGGCGGCAGCTTATAACATGCTTATCTATTTCTATTTAGTGAACCATAACGCAACGAGCGATTCGGCTGTGATCGA
AGCAGTTGGCCTCCT