Description :
From Genome Similarity Track
Location :
Scaffold_3:37852- 39273
Transcript NameFunction/comments
g18682.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
1421 bases(100 bases per row)
GAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATATACTCCCGGACGACATTCCT
GCGGAGGTACCGCAGGACAAGGGTAGATTGATCTCGTGCCGGGAACGAAGTATTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCCAT
CGACGACTTCTTTGAAAGTCGTCGCAAGGCAGGACAAGTGCGGGAATCAAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGG
TGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGA
GTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCAT
GCTCTGGGAGTGGCTCGTAACGCCGCAGGGGTTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTCGCGCTCCGTGCGCGACTTCGCA
CCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCA
TGCGAAAGCACAAGCTCTACGCGAACCTAAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCC
TGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTATACGTGAGCAACT
ACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGGCAAGCAGGG
CTTGACTGAGGCGCCGATCTTGGCGATAGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAA
CTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGTAATTACCCGGTACATGACAAGGAACTCCTTGCCA
TGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGCACGGCGACCAAGTCGCC
GCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGATTGAATGTCGTGGCCGACGCG
CTTTCGCGTCGACCAGATTAT