Description :
From Genome Similarity Track
Location :
Scaffold_2298:3785- 4978
Sequence
1193 bases(100 bases per row)
CGTACCGAAATGTGTGGGGTCTCATCCGTGTCCTCTGTTAGCACTGTGGGCGTGCCGGCGTCACCACGGGCTTGGTCGACGGTGGCGGTGTGGTCGTGGG
TGGTGGCGTGACCTTTTCACAGACGTTGGCAATATCCAAGACGATGTACCGGTAGAAGAGGTGATCGAGCCCGCTTGGAGTGCGCACGATGCAGTCGTCA
TCGAATTCCGACGCTCCCGTTGGTGGCTTGGTCGGTCTGGCGGCGAGCACCGTGGCCAGCAACGCGCGACACGGCGTCGCCGAGCAAAACGCCGTCGCGA
CGGCCTGAGTCGCGGACGCGAGGTCCTTGCCCGAAAAGCCAGTGGCCTGCTTGCAGGCCAAGCCCTGGCCAGCGTCGTCCTGTGACCCACGGCGACACGA
TCGACGAGCCGCAATTGGGAGGCATTGGGGGTGGAAAAGTCAACGCATCCACGGACGAGACAATGACGGCTGCAAGCGCGGCAATCACAACAAGCTTCAT
TGGGAGGGAGAGTTTGAGGCTAAGTTGCTTTTACTAGGCCGGACTTGCAACTGTCATGATCCCAAGAACCTACACACACAGAAGCCGAAAGGCCGGAGGA
TCCTTGCAATGCGTGGGTTAACCGTGAACCGTGAGGATCCAATGAAGCTGTATCGACAGTTAGTGGACGGATGGCGAGATCCTTCTTCCGACTCACTACC
ACAGGAGCAAATAGCGGGCTCCTCACATTNNNNNNNNNNCGCTGTGAAAGGAAACTTGTGAGCTGCACGCTCTCTCTCTCCATCTCCAGCGCGCCCATTC
GGATGGACGGAACATGGAAAGCTGGTGCACTAACTGGAGGTGAAGAGCTCGATTGTCGGGCGCGTTGGACGGCGGCATGATGCAGGATCATTGTTCCTTC
GTATCCCAAATGCAATTATGTGCATACCTGTAACGACGGAAGGCTAGTAGCGAGGGTTCTTGCCCTCTCCCGAGTATGCCAACATCCAACCTCGGCAACG
TCACGGTTGAAAGCTTGTTCTTCGTGTTTCGATCGAGGATTTCCTGGCGCGNNNNNNNNNNGGTGCTGCATTGGGGCGAGAAAGCTGGGACCCTTTCATC
TCCATTTCCCTGATCAAGACTTTTGGAGCGGACTGTTCGTCGTAGCCACCAGGCTGATGTAAGGGCGACGGAGTGCTTCGTTATACCCCTAAC