Description :
From Genome Similarity Track
Location :
Scaffold_55:37847- 40724
Transcript NameFunction/comments
Phypl_g1948hypothetical protein PHYSODRAFT_478276

Sequence
2877 bases(100 bases per row)
GCCGGAAGCTTCCGCAAAGTCCACCTCAATAAtgacgaggagaacgagcggCTGCGACGCGAAGGCAGATACGCCGATAACTACGTGACAACGTCCAAGT
ACACAATCGTGAGCTTCGTCCCGAAGATGCTCTTTGAGTTTTTCCGGGTTATCGCCAATTGCTACTTCTTGGTGATATCGATTCTTCAGGTGGCCACAAC
GTGGTCGCCGACAAACAAGTACACTACAGCTGGTCCGTTGGTGACAGTGTTGATGGTCTCTATGATCAAGCAAGGCATCGAGGACAAAAAGCGGCACGAC
GCTGACCATGTCCAGAATTCCCGACATTGTAAAGCGCTGGGGCGGAACGGAGAAATCGTGACGAAGGAGTGGCAGGAAGTCGCTGTGGGGGATATTTTGC
GCCTCGGCGACCGCGATGAGGCTCCTGCGGATGTGTTTATCCTCTCCACGTCTGAGGAAGAAGGACGGTGCTTTGTTGAAACGTGTAACCTGGACGGCGA
AACGAACCTCAAGCGAAGATCCGCCATTGAACAAGTTGCACAGCAAGTTGGCTATAGGAAACTGAACGACCCCGTACTGCCCGAGAGTGACCACAGCAAG
CAAGTGATGAAAATTAACGCCACGATGGAGTACGAGCAGCCAAATAACCGACTGTACAACTTCACAGGCAGGATCGAGTTCGGCCCAAACAAGGAGGCTG
CTCCAATCGGCCCTTCCAACATCATTCTGCGTGGCTGCAGCGTTCGCGGCTGTACGTACATATACGGGGTCGTCCTCTTTACCGGTTCCGACACGAAGTT
GATGCAGAACGCACGCTCCACACCGTCGAAGCAGAGCAACGTGTATAAGGTTGTTAACCGCTGCATCCTGCTGATTTTCATCATGCAGTTCGTGCTCTGT
ATCATCAGCACCATTTGCAACACGATCTGGatggacaagtacgaggagaagctctgGTACTTTAGCTCGGCCATCACGCGCACGTCGTCCGCTTCCAACT
TGGTGAGCTTCTTCACTTTTCTCATTCTTTACAACAACCTGGTCCCGATTTCGCTCTACGTGTCGCTGGATATGGTGAAGGTCATCCAGGCGAAAACCAT
CTCCAGCGACCCCGAAATGTGTCACGAGGGGACGTACGCGAACGCGCGGACGTCCGATCTGAACGAAGAACTGGGGCAGGTGCACCACATCTTCAGCGAC
AAAACGGGCACGCTCACGTGCAACATCATGGAATTCCGAAAATGCTTCATCGCGGGTGTGTCGTACGGTTTCGGCACAACCGAAATCGGTCGTGCTGTTG
CCGAAATGGCAACGaaaaatgctgctgctaagGGATTATCAAGCGGCTCTGTTGATGCAATCGATAacggagaagacgacaagcagcacgacccACGGGA
CGCCCAGGTTGACTTCAATCCCCTAATTCATTTTGATGATCCACGCCTAGTCAACACACTAGCTGCAAATTCCGCAGGGGCGGCTGCCATTGATGAATTC
CTCACGGTGCTTTCCGTGTGTCACACGGTGATCCCAGAGAAAAACGCGAAAACCGGTGAGATTGACTACCGTGCCTCTTCTCcggacgaagaagctctgg
TAAAAGCTGCTAAGTGTTTGGGCTACGACTTCttcgctccagcaccgctCTTGGAGGTCAAggtgaccaagaagaacggctCGTCAGCTGTGCGGAAGTA
CACCATTCTGAATGTGAATGAATTCAACAGCACCAGGAAGCGGATGTCGGTGACGATTCGTACCGACGACGGACGCTACTTCCTCTACTGTAAGGGAGCT
GATAATGTCATGATGCCGCGCAGTAAGTTCGACAAGTTCACTGCGAAaatggacgaggagatgaagcgaTTTGCGACCGAAGGGCTTCGGACCTTGGTGA
TCTGCAGCAAAGAGCTGACAGAGGAGGAGTATTTGGCTTGGGATGTCAAGTACCAGGAAGCCGTGACGTCTCTGACGAATCGTGATGAACTTCTGGAGCA
AGTTGCTGAAATAATCGAGACCGAAATGAAAATCGTGGGCGCGACAGCAATTGAAGATAAACTTCAGACGGGTGTCCCCGCTGCGATCGCGAACCTCGCG
CAAGCAGGGATAAAAATCTGGATGCTCACGGGTGACAAGGAGGAAACCGCGATTAACATCGGCCATGCCTGCCAGTTGATCAATGAAGGAATGCAGCTTC
TCATCATCAACTGCGAGGATCTGGACGATTTGGGCAGGCAAGTGGACAACATTTACAAGCTGGGAGATGTGCAATCACATATGAACGCCAACAAGGTTTC
CAGTCACCTCGCCCTTGTGTGCGATGGCAAAGCGATGGTGCACGTGTTTCCACCGAAGAACACGTCGTCGGAGCGGGCACTGCATGCAGCGAAGGTCCTA
TCGCAAATGCTCTTGGACATTTCCAATGTTTGCCAAGCTGTCATTGCGTGCCGTGTGTCCCCTGCTCAGAAGGCGGACATTGTCAACCTCATTCGGTACA
ATTCGCCTCAAAAGCCAATCACTCTGGCCATTGGCGACGGAGCAAACGATGTGAATATGATTCAGTCGGCTCACGTTGGCATCGGTGTGTCCGGCCAAGA
GGGCGTCCAGGCTGTAAACGCTAGTGACTATGCTATCGCGCAGTTCCGTTTTCTCgagcgacttcttcttgtccacggTCGCTACAACTACCAGCGGATC
TCCAAGGTCATTCTCTATTCGTTCTACAAAAACGTCGCACTTGTCATCGCACTGTTCCTCTTCAACTTCTATAATGGACAGTCAGGTACGAGTGTGTTCG
AGAGTTTTGTCATGGCTGGCTGGAACTTCTTCCTAGCGTTGCCAATCATTGCGATCGGCGTTTTTGACGAGGATGTC