Description :
From Genome Similarity Track
Location :
Scaffold_4:378423- 380118
Transcript NameFunction/comments
g3606.t1ETL47067.1 hypothetical protein L916_03145, partial [Phytophthora parasitica

Sequence
1695 bases(100 bases per row)
ATATTCGCGCTGGGGGCGGCTGCGTGCTACGGTGGCCTGTTCACGGTGCTCTACTACTTCACGCGCTACCGAGAGCACATCAAGATGCAGCTCGGCGCCT
TCATGGAGACTGCGCAGACCGGAGACTTGCGGAAGCACGTCAACTTGCGAGCGGACCGGAAGCTCAACACGACCAAGAAGATCATCCCCGTCGTGCGAAC
GCGACTTTATTACGCTACACGTCGCGGTGATCTGCATGAGATGCGCGAAATTCTAGAGTACGCCAAGGACAAAGGACTCACGAGCAGCGAGATTGGATTT
CCCCGCAAGATTTACGCGGCTCCGACCATCAGATGGCGGTTCTTCGCAAGGTCGAGCGAAAACCCGGTGCATATAGCTGCTAGCCTTGGCAATATTCGCG
CTTTAGAGCTCTTACGAGAGTTTGAGTTTGACTTGGCAGCACTAGACAAAGTGCAGCGAGTGGTGATTTCGACCGGTGGGTTCTTCTGGCACTTCATCCA
GCTCGTCGTCAAGCGCCCCGAGCGCAGCGACGAAGACTCGGCGAACTCAATCTTCCACACAACGCTGGTCACGCCGCTGCATTGTGCAGTTGTTACAGGC
CAGCTGGAGACTGTGCGCTGGCTGCTGGAGCGAGGAGCGCCTCCAGGAACGCTTGCCCAGGCGTCATTCAGATCGAACCGCATCCCGCCGCTGTATCTGG
CTGAACATGGTGAAATCGCTCGAGAGCTGCTGCTGCACGGCGCTGACCCGCTCGTGATCCCCGACCCAGGATATATGAACACCATGACGCCGCTGCAACT
CGCGTATGTCCGCGGCAACTACGCGGTGGCTCAGGAGTTGGAAGAGTGGGGCAGTGACGTCGCGCTCACACCATTTCACCTCGCGGCAGCCCGCAATAAT
GTCAAAGCGGTGCGAAAGTTCATCGCGCGCAAGACGGACGTGGACTGTCTGGGTGAAATGGGCTACGTGGGTCTCAATCGCCGCACGCCGCTGCACTGGG
CTGCTATCAGCGGCTCGGCGGAGGCGGTGAAAGCGCTGTTGAAAGGGGGCGCTGACCCGAATTTCCAAGATGTCCGTGGACGCTCGCCGCTGCATTGGGC
AGCAAAGCTAAATAAGCTGGAGGTTGTACACTTGCTACTTCGAGCTAAAGCTGACCCCAATCTGGTTGACAGTGAGTACATGACGCCGCTCATGTGTGCT
GCCTCCGCGCTGGATGCGTCTCGGGAACTCTTCAGTGAACTGACATACGCAGGAGGCAACATCGGCTACCAGTTGCCGATAACGGGCGACACTGCGCTGC
ACGTTGCTGTGCGAGAGGAGAACCAGGAGTCAGCACTTGCTGTCTTGGCGAATGGTGGTGACCTCATGCGAATGAACAACGAAGGGCTACGTCCACTCGA
CTGCACGGCGAATACGAGGCTACTCTTCGAACTCAAGCGCGCCGCTGGTCAACGCGATGTCATGATCAGCTACACGCACTCGCATCTGGAGTTCGCGCGC
AAGCTACGCCAGTCGCTCGAGGAAGCCAATATCACGACGTGGTTGGACCTGATGGACCCGAGTGGCATCGGCGGAGGTGCCGTGTGGCGTGAAGAGATCG
CTCGTGGCATCACGAATGCATCCATTGTGCTCTGTATCCTGACTGAGGACTACGCGTCTTCAGAGTGGTGTCTGAAGGAGCTGGCGCTGGCCAAG