Description :
From Genome Similarity Track
Location :
Scaffold_18:378422- 380774
Transcript NameFunction/comments
Phyca_LT1534565494peptidyltRNA hydrolase putative
Phyca_LT1534545523calcineurin-like phosphoesterase, putative

Sequence
2352 bases(100 bases per row)
atggaggacgtggcctggaagtgcactgcagccttcgtgctgggcgctgcaactcactacttcgtctcgtcgtacctactgaatgacactacgaagtcct
cgagcagtgacatcaaggacagcagcagcgacgtcgagcctcgctctgccgcctcgtcccggtcctcctccggctcctccgacgactgggagggcgagga
ctcagccagttgggtgccccacaagatggttatgtgcgtgcgcaccgacttgaagatgggcaagggtaagatcgcggcccagtgctgccacgcgacgctg
ggcgcgtacaaacgcgcgagtaagcggacgccggacgccgttcgcgcgtgggagatgttgggccaggccaaggtctgcctgaaggtggactcggaggagg
agatgctcgctctggcagagaaggcggccgagcacggacttgtcaactacgtcgtggtacgttgactgttgtagctgtgctggggtggtttaaactgatg
gtttcgtgctacagattgatgccggaaggacgcaaattgcacctgaaagcaagacggtgctgagtattggaccggctccactgaaggtaatcgatgaggt
cacaggccaccttaagctcatgtgagctctgggattaaacaggaaggcagtatctttgattgagtggctccacgatctttacatgtgtacgtgcagttcc
tttttgcatgatgacagtgtcaaaggaggctgcagctatagcgtcgcaatggtgtcgtactgcgagcgatttttcaggacaccagcacgctggaggatga
acacggtcaatgcaacgcacgccactgcaacgacagtcgctaacgctgtcgcttcgatcgttgtcaatacgtcttttgttgcaaaactggtgtctgaggt
gctggaatcggaagaggctgtaaccacatcagcaagcatcgcttctgcagtgtcgacacaagccaggtgctcacccttcgtagtccaccacttgagcgta
cacattgtcttggcatagcaggctacgtccttgcaagggcgagcgttgggagagcgagccttcatgttcaagtagtaggcttccactaagctcacgttct
gctcaacacgctgcgtaaaagccgatagttcggacaacgacagcgattggaggccgtacgcttcgcttgccttgaacaacaacttccagtcgagttgagg
gtcactctccgcgatgtaagaggcatacacggcatagtcgagcacctcgtacgtcttggtatcgtattcccagaccatgaaagacgggttgttaccgaaa
agtggcgagattgatcccgtaatgtacaacggtagaagctggaaggggtcgtcctcccctgtaggtccatcaagcgatgtcacaggtacacggaactcga
cactgtgcacatggccaaagaactgcgccttgatcacgtcggcatactttccaacgatgttcttgtacttgacgatgtactttgtgtgccactgcgggtt
gcctccatacgagtccacaattggagcaatatgaccagcaatgtatgcgaatttgccggcgtcctgcaactccgcaagagtcttatccaaccatgcaaac
tgaccaaacggatctggttgcttcgacgtgtcaggcacatgactcggctgtatctcacacagaaaacttgtcagtaattaaacactacaaacagccactt
caacttaccgaatagggcaccgtattcagagtgatgacgtgcaacctgtcgtccagtgcgtagctcagaaatccacgtcgatttagcagatccaagttcg
ctgctgacagcgagtcttcccacacctcagagatgatctcaatggacgggttcgtctccttctccgggtccgtcaccagcatgtgatagtctgggtctgc
cattacgagcaataaacacacatcagtcttcctcttcatatacaaaaagcctttgcagctttcttactcccgtctgcgttgccaacgacggccgtgactt
ccagcttcccgtcctgacgcttgggcggataataattctccatcacgtggacatttttctccacagctttagcaatatattcgtcggtgaatagtccgtg
cgctgtgtggtcccctgtatacaagaagagctccgggtcggccaccacgtgctctttggcgtaaaccagagcggactcgagaagtgccaaaggagcgtct
tggaagtaagagatggggatgcgagcgtcgtccgcagcggaaaatgactgggaaatgttcaagtgcacgtccgagaagtgcaggatgcgtcccacagacg
ctgcagacgcgggcgcatacagcagcgcaagcagcgtcagacctagcatgat