Description :
From Genome Similarity Track
Location :
Scaffold_77:37838- 47278
Transcript NameFunction/comments
Phyke_g3247hypothetical protein PHYSODRAFT_313163
Phyke_g3248hypothetical protein PHYSODRAFT_345492
Phyke_g3249hypothetical protein PHYSODRAFT_397963
Phyke_g3250hypothetical protein PHYSODRAFT_313159

Sequence
9440 bases(100 bases per row)
CAATGACACAGAGAGAACTGATCCACGAACTCGTGGATCGCAGTCGCGAACGCGTCGCACAGGTACGAGCCGGCAACAGTCTACACcgcgtgctgcagca
cgaTGCCCTGACGCACTCGCACTCGTCGCCCAGTACACTTCCGTTTCTgccgccagcaccgccactGGCAATCATGCCCAAGCACAGTATTCGGAAGGCG
ACGCATGCGGAGAAGGGCGACGGGAAGAAagatcgacgacgtcatggTGTGCTACCACTGCTTGCAGCGAGCACGCTGCACCTCCCCGTGGAGGCCTCAT
CGTTCGATCAGTACCAGCATTTCATGGATAGCAAAGTATATCGGGAAGAGACGTTAAACCAGCGTCAGCGCCGCGTTGCGCTCGCCCCACGAGCGGATCT
GCTCAAGAAACTGGCTGTggtctgtgctgctgcacttgcagaagtggagaaggagacgaaTGCCCCCATCGTACGCGAGTCGTTGCGtgaaaagctgctg
cgcgCGACGGCTTTGCTCCGAGGTGGAAGGGCCTTTGAGAACGCCAAAATGCtaccaccaccgcctcctCCTGCGTATGCTGAGATAAAGAATGCGCATC
TGGCCTTCCTGGAGTTCAAGCGCGACGGAGTGAGTCCCACCAAGCAAAAACGTATCCACCCGTGAGTACTCTCCCTACACCAACGATGCGAATGATATAC
TTGGATCCTCCAGGTTAACGCATGCATTTTGTTTTGTCTGGGGAATTCTTAACACGTCCACAGGAGTGCGGGACTACAGGACGTCAATACGTCAGCCAAG
ACGCCAATCCACTTTGGTGACCAGATCTGCCTTCTATCTTCCATGTCGGACGTTCCTTTGGCTATTGGGCCAGATGGTCGTAGTCGTGCCACACTAGACA
GCTCTGTTGGGCCGCACATGACCTTCACCATTGTAAGACTTATTGCAATTCCTGAGGTAGGTCATAATGTCGGATGTGGCTAACACGGAATTTTCGCGAC
GAGATCAGGTGGACTTCCGAAACCCATCGCGCTACGACGAGGTCACTGCCACAGATGACTTTTGGCTGCGCGTCGACCCCACATTCTTGGCACCTCGCAA
GCACTTAGACCCCCAACGACTCTATTTCCACCGTGGGGACTTGGATCAGGCAGATGGAGgtgatgaaggtgacgacTTGATATCATTGCTCAGCGACACA
AACTATTATCTAGGTTGCCCCGGGTGGCTTGACGATGACCAGCAAAAAGAATCAACCACTTCGACAAATGGCCCAACAGGACAAGCGAATGGCAAACATA
ATAATTGTGTGCAGCAACGATTTCGCCTGGTGGCAATGAAAGCTCTGACTCCCGCGAAACTTTACTACGGCGATGATGCGGCTACACGTGAGTACAGTAT
CGAGACCAATGAGGCCATCATGCGCCTTGCTCGCTGGCGATTCATGCGATATACACCACGACGATATGAGCAACTGATCGATAAAGCTGAACATACATGC
ACTATTAGATGTGGTTGTATCGACAACAAAGAAGACATCAACAACGCTTTGGTGAACTGTTCGACAGTTTATCTGGTACTCAGCGACTTTGCTCTTACGT
ACGACAAAGTATTAAAGCGTGGTGTGGGAGTAAGCATTCCCTCAGATGCACGCGCTGCGTCTAAACAAGTGCTGCGACTGTATGATCGTCGGCATGACAA
GAAAACACGAAGTCACCATcacatcaacagcagtggaGACGGTGGAACGGCCGCGAAGGTGGCCCAGCTTTCAGATTGTGCACGATGGCAGGTACGCCTC
TTGCAGCGTACTGGTGAAGCGACTCACCTACAAAAGCTGGAATCGGCTATGGCAGCACTCTCAGATGACGTGCGAAAAGAAGACGGCGAAAGGGTAGAAT
GGCTGCGCAAAAAGCAAGAGAAGATGGCTGCGAACGAGCGGCGAGTGCACGCAAATAATGGGCTAGTGCTCAAGGCTCGTCAGCAATACGACCTTGTAGT
AGTAGAAAGCAACAGTaaactggagcagatcgAGCGACAGAAGGCTGCGCAGGGACACGAATATTTTCAGCGCCGGCTTCAGGTACTTAAAACGATCGAG
AGCAGCCACCAATCTCATGAACTCGCACAGCTGTTGCATCAGCAACTCCAGAGGGTGGTAGAGCTTCCGCGGCTCTGAAAACAATAGCTTGGTATAACTG
TGAAGTGAGTCGCTCTATTATAGCCCGGCtggttcttcttcgtcgtcttttCTACTGTCATCGAGAGAGTTGGTATGGCCGTGCTTTTGTTTCCGCTTCT
CGCGCTTTCGTCGCTTGCGATTCTCCTTCTGTGCGGCAGACAACAACTTGCGCTTTTTTCCAGAACTACTATTGGAAGCTGGTACAACGTTGTCACtcga
agaaggtgctggagcttcgACACTTTCAGCTGGTGACACATTTACAGTTTTTTCTACAAACACCGCAGCACTTTCATCACCAGTCCTATCCGAACGCTCG
AAGTAAGCTACGAAAAACCCGTTCGTTGAGTCCTCGAGACCGTTAGCACGCACAAGTGCCTTGGCCTGTTCAGCCGACAGACCTGCTACCTCAAGTCCAC
GGCGTGGCCACGTAGTCAGGCAGGGTTTCAGCACAAACGGTCGTGAGGCACGCGTATTTTCCTCGGATGCCAGCGCCGCAGCAACCACTTCCTCATCCTC
TTTCTGGAAAATAGAGCACGTGGAATATACGACGCGCTCGACCTGTGGGAATGAAAATGCCTTCCGTAAAGCCTCCAACTGAAAGTCTGCAAGCGATTGA
AGGCGCTTGGCAGTGTCCTCCTCATACTCGGCTCCAGCGTCTGGCTCCAGTACCGTGTCACGGGCGCTCGCAATGTCCAGCAAATGATCTAGACGATTTG
TCATGCCGGAACCGGAGCACGACGGGTCCAGCAAAATGCTGCGCACGTTACGGTACAAGTCACCATCCACAGGAACCTCTAGGAAGCTCTGTAGTTGAGC
CTGCACACGCTCCGCAGCGCCGGCGAGTTCCATACGTCGCTTTAATAGTTCAAGTCGCTTCGGTGACCGATCGAACGCAAATACATGATGTATGGGAgta
tcatcaccatcatcagtgtcattctgctgctggagcagcataGCCAGATGGCTTGTCTTGTTCCCTGGCGCAGCGCACGCATCGATCACGTCACCTCGTT
TaccagctgcatctgcatgcTCCCCCTGTAGCACAAACGCAGGGAAGCAACTGGCCTTGTCTTGCAGCACTAATTTGCCGCTCTTGACCATCTCATGTTC
GTGCAGCTCCGTTCCCGAGGGCAGAACTAGCAGGTCTCGCACGTCTCGGTCTTGTTTGGCGTCGTACTCCTTCACGAAggcttccacttcttcagATGCA
GCCAGCAATGTGTTAATTCGCACATAACGTGGCAGAGCGAGGTGTTGCTTCCGGTTCTCAGGCGGTAGAAGCGCCTCATTCGACGCCACTTTACGACGGA
TCTTGAGTCTCGCCAGAGCTGCTCGAAAGGCTGATTGGTGCTGCATAagcgccttcttgacgtAGCCACCGCCCTGGATCTTCAGTCTCCCAAATAGGAG
GTCGTAGAGTGCCACAAACACGAGCGCAGGAGGCTCTTTGGCGtctttcttggtcttcaggGCCTTGTAACACTCGggcacagcagccagcagctctcGC
AGGAGCGGCTTGTACCGCAGAGTCTCACATACTAACGCGAAGGAACTGCGTTTGTGGACAGTGGAGTCTGCATACGCTAAACTCTTAAGACCTCCCTGAC
GGAGCTCTAACTTGTGCAGTAGTGCGGCCGCCTCCTTGTACAGCTCGCTCATAATGACTTGAAATGCTCAATGCTATGCAGAATGAATGGTCATTTTAAG
TAAGAGGCAGTCTTTCGAGGGAgtgacatggctacattatgtgacgtgtgagaatGGCTGGTGTTCATTTACTGCGATCCAGATCGAGTGCAAAATTGAT
CTCACTTGGCTTTGTTAGACTTACTGCAGGACACGTTCGCGACGATCAATATGGCCTAGGCAGAGTATTGTGTTACAAACGTGATAGTATCAGGACTCCT
CTTAGACCCTGCGTCGTGGGTTGGACTAGCAGTTTGATGGGGTAATGAAACTTCACGTTTGCTCGAGGTAAGAAAGCGGTGAAACTAAATGTCGCCTAGA
ATTTCAATCGTTAATACATAATGTGACACTTGTGCCCCCCATAATCTGTTAGTTGTTGTACTTCATTAGGCAAGACGCCACCGTCCGAGTTGACGGGATC
AAAATCATTTCCCTGCAATTCCCTGCTTCCACACGCGTGGAGGGCCACAACAGTCAGATGATTGCGAACAAATACCATCAACTGAGCATTGACGCTACTC
ACAAGAACTCCAGCTTTACCAACTTCCCCAATGAAGATGGAATAGCGCCTATGAAGTGGTTTCGGTCGAGACGCAATATGCGCAGCGTAGTGAGCCGTGA
TAGTGTGTCCGGTACGTAGCTTGTCAAAAAGTTTGAGCTTAAGTCCCTGCAGGTGGCGAACATAGGTCAGATATCAATTTCGTTGTGTACAAGACATGAT
GGGTAGTCGACTCACAATTCTTGCAGTCCACTAAGTCCCGTGCGAGGAAACTCTGGTGGGAGGATACCCACAAGATTGTTATTGGGAAGACGACTGGATC
AAAAACGAGCTCAGTTTTTGAGGTAGGTTAGCGGGGAAGCGGATTACACTTACATGGAGCGAATGCGGCCTGTGCGATCGCATACGATACCATACCACTA
CAACACAAGCCAACCACCAGAAAACGCATCAGATAAGACCAGCAATGATAGCCTCGAACGTTCACGTACACTGTCAAGGCACGGGTCGCTGTATTTATTC
TGGACATCCCACTTGGTCATCCAGTTCTGGCCATGCGTGGCCCAGAACAGTAGCTTGAGCGCGCCGCGCTCGTCTTGGGTGATGGCAGTTGCCAAGGTCG
CCCATGTCAATGCAAGTAGCACAAGTACAGCAATTCGACGCTGTGTCATCGACGTCCAGGAAATGTAGCTTTGCGTAACATGGCTACAGTTTCTAAAAAA
AACTAGCACCTCCTTGGCATAACGCATAATCATTCTACAGTAGAGGTTCGCTTTGAACACGTCTAACACCATCAGccgagatgctgctggaaaagcCTGA
GGACGTCAAGCATGAGAATGCGTCGGGCACAGGTACATGGTCTCCCTCTTCTTCAGatccttctgcagcaactggtcCCTCTCAATTGTCCTAATTCGCT
TTGGTTCCTGCGTTATATGGCGTTGAAAATGCACGACTTTAGTCTGCGCCATCTATGGAGTGGACGCCCAttcgacgctgcagctgtttGCAACGGCTGG
AGGAGACAACACCGTCAAGATCTGGTCACTGCAAACGCCTGTGGAGGGCGGCGGTATCGCCACATTCGAGTTGTTGGCGACGCTGGCGTTCCACCAGCAG
GCTGTGAACTGCGTGCGTTGGGCTGGACACGGTCGGTATTTGGCCTCAGGCTCCGACGACCAGTTGGTGTGTCTCTATGAGCTACAGGAGGGAGCTCCAG
CCCCAGTCCCCTTTGGCTCTAATGCTGCGCGTAATAAACAGAACTGGGTGCGTTGCTCCACGCTGGAGAGACACACGATGGGTGAGGAGAGTGGAAAGAA
GGTGGTTGCAGACACACCTCATGACTAACGATTGGCCCATTGTTTTGACTGGCGTAGATGTGGAGGACATTGCGTGGTCCCCAGATGACCGCATGCTGGC
TACCTGTAGCATTGACAACACAATTTTGATCTGGGGTGTGGGTATTGGTGGGCTGAGTGAGGTCATGACGCAGCCGCTGCAAACGTTAACGGGGCATAGT
GGATGGGTCAAGGGCGTCGCGTGGGATCCTGTTGGAAAGGTAGACTCCAGGCGAAGTCGATTCGAGAACAATGCGTATGATTCACTGTCATGTTTGATGC
CttttgctttttgttgcAGTATTTGTCAAGTGCTGGCGAGGACAAGACCGTGCGTATGTGGAAGGTGGCTGACTGGCAAGAGTCTGACGCCGTGGCTGAG
CCGTTCGAGGCATGTGCTTCCACATCACACTTTCGTCGGTTGTCGTGGTCACCCGATGGATCAGTGCTCTGTGCTACGCATGCCTTTAGCTCCAAGAAAA
ATATCGCGGCGTTGTTAAACCGTGGAACCTGGACAAACGATCTCAAGTTTGTGGGCCACCAAGGCGTTGTAACCTGCACGCGATTTAACCCGAGACTTTT
AGGTATGTCCTTGCGACGTGCTGCGAATCGAGGTGTATCTGATGATCATGAGTTTTGCTTGTCATATTTGCTATGTAGTGAGCGAAGCAGACCCGGAAAA
AGATTTTGCATGTTGTGCGGTGGGAGGTGAGGATGCAACCATAAGCATCTGGTTGGCACACTTGGCACGCCCATTGGCTGTCATCAAGGACTGCTTTGAC
GCTTCAGTCACAGATTTGACATGGTCCAGCTCCCAGTCACTACTTCTCGCTTGTTCGCTCGATGGATCTATCTGCTGCTTTCAATTTGGAGGTGATGAAA
TTGGCACCCCTATATCTGAAGCCCAGCAGAGCAAGTTGCTTCAGGCAAAGGTATGTCATTTTTTTATCATTTGGGGATCCCCATGCATTATCCAGAGACT
TGACAATATCTTTGCTATTTTCATGATGTATATAGTACGGCTCTCGTGCTGGTATTACACTCGCCTCAACATTGGTGGAGAACCCAATTCAGCTTCAGGT
ACGTTTGTTTCAGCTCGTGCAATGGGGAATTACGAGCTAATCAAATGCGTTTTACTGCTTGCAGCTAGAAGAAAAGTCAACGACTTCTCCACGTTTGACT
ACCAGTAGAAATACTGGTACCAGCGTTTCGTCGACGACAACTCACACAACAAATACACTCATcccaaagaagaagaaaaaattGAGTGCTCACACATCAA
GCACGCCTCAAAATCGACCACCGAGTGGAGCAAATAAAAGtgacaagaagcgcattgcTCCAGTATTACTCCAGCCAGACGCACAGCCTTCAGCCAGTAa
cccagcttcttctcaaaACAATATCCGCAACATCTTGGGCCCAACGGTTGTGTCACCGACGGCCTCGGATGTTACACTGTTGAATGCTCGCATGACGTCG
ACTACTAAGAACGGAAAAGAGGTTGGCGTTGTCCCCGCGACAAGTAATTCTGCTACGCTTACGCCGAACGTTGCATCATCTGATAGCGCAAAGAGTGTGC
CCGTCTCCAAGGAGAAGCCTAGTACATCGTCGGTGAGTGATGTGTCGTTGAAATCGGaaacgaagaagaacgggaCCGATAACGTTTCTCTAAAGAGAAA
AAGAGAAGGGGACCGCCCTGCAACTCAGGCAGCCTCTTTGGGAGTCGCGAAACCAAGAGAAGTGGTCGCGCGGGCACCGAAGCTACTGAACGAAAGGTTT
GTTTTTGTGCCATATTGACCATCGATGAAAACAAACTAACAaatccccccccccccccctaTTGCCTTGCAGTAGTGCTGGTACTGCTAACGGCGGTCAA
ATATTGCCCCAGTTTCCATTCCGACTACAGTTCTCTGTAGAAATCGACGCAAGTACACAGTCTAGCATCTCAAGCTCGAACGTCAGTACCAGAGCTCGGG
TGACGTCTTCGAAGGTTTTGGTCGAAGTTAACGTTCACAACCTGAAGAATCCTCAGCCGGAAGAAATCATAGGTGAGCTACCCAGCGATTGATAAAATCT
GTATGATCCTTGCTCACATATAATGTCTGATGCGCTTCGCCGTTCGTAATGCCCACCAGAGTTAGGACCAGTTTATTCTACGATCAAATGCTCTGAGGGG
AGCGAAGTTAAGTGGATCGACCGCCTTCCTGGTCGAGCAGTTTGTGCTGTTGGAAACGCGGGCTATTGTGCGATCGGGGTTCACAACGGCAATCTCTTAA
TTCTGAATAGTAGTGGACGCCGACTGTTTCCGTGCATCGGTGCGTACGCTTATTTGAAATGGGAAAACTGTGTGGATTTATTTGCATTCTTACGTGGTGT
TAACTGTGTGTTTGACAGCTTTGGGTAGCGCGATTTCGGTCATCGAGTGCAGCGTAGGTTCCTCGCCTTATCTGTTAGTGATTCTTGTCACGGGGGAACT
AAAGATCTGGGACCTAAGGGCGCGCAAACTTGTACTCTCGAGCTCGATCGAGGCGATTACGAATGTACGAGCTTCTTTACTACTTTGATGGAGTTTGTCA
TGTTCTGATTGTGGAAGTATGCTTGCTCTCATACTGCACAGTTAACATTAGAAGATCAGCACAAATTGACCCTTCTCCGTTGTCAAGTGACAACAAAAGG
AATGCCCCTGGTCACGTTTGCTGAGTCAAACTCCGAAGTGAAAGGCAGTTCCAGTTTGTTGTCGTACACTTTTGACACAGCGATGTCCGCATGGTACGCT
TTTTTTCCCTTGAACAGTGTACCTGAAGAGTGTGAGTGAGAGTGACTTATCTCGTTTGATTCTCTCCTCGATGCAGGATGCGTGTGGCAGACGACAGCTT
CGTATTTTCAGACTTCACGTCTGCTCTGCCGACCGATGCTGTGGCTGTCAAGAGTGTGCCTGTGCGTATCAATATGACTCAGCGATTTCTGCGTCGTAAC
ATGGTTACTGATTGGGTCGGCTTTGCGTTATGCGTGCTAGGTTGGGCCGCTACGGCGTCTCCAGAACGCCTCCGGCTACGGTCGGACACAAAGAGGTATT
GCTTCGGCTATGCTTTCGGGGATGTCGGATCCTTTAATGCAGCGCAACGTGACGCGCTCTCATCTTGAGCACcaggttgctgctgcaattaTACTGAAAA
GCCCAGTCGAGTATCGTTATTGGTACGTACTCAACTTTGAGCTGCATGATACTTGTCATGATGTTAATAATTTCTACACGCCTGCGGACAACAACAGGGT
GCAAGCTTATGCAAGGTTTCTGACCCACGACGAGGACGTGACTCGACTGGACAACCTGTGCGCTGAAATGATGGGTCCTTTTCACGCGTAAGTTCTGTGC
ATGTGAACAGATAGCGTAACGATTTAGTGATGCTAATCCCGATATCTTTTCACTGCGGCAGGTCATCCGATCCAAGAACGATGGAAGCAACTACAAAACC
GGATGAGGGCAGCACGTGGAATCCAATGGTGCTAGTACGTGGAGGCGGCATGTCATAACTTTGTGTCATAtacccaccaccaccactgacaaTTTGCGCT
GACGATCATATGGCAGGACCTCGTGAAACGGGacgtgttgaagttgcaaaTTCTTCCGACGATCGCGACAAATCGCACATTACAGCGAGTTGTGACCAAG
TATCAGCTTATGCTCAGCGAAATTGAGGCGCGCGAGGGGG