Description :
From Genome Similarity Track
Location :
Scaffold_38:378352- 381280
Transcript NameFunction/comments
Phyra_79282Voltage-gated Ion Channel (VIC) Superfamily

Sequence
2928 bases(100 bases per row)
CTACAGGCGCTGATAGCGGAATGAGTTCGCCACAGGGCGAAAATTCGGCAGAGGCAGGAGAAACGCTAGCTGGGTAGAGACAAGACTGAACTGCTCGCGC
GATGGTGCTATCATTTCAGCACACGCGTTTCACTTGATTATTGTAATTACACCACCAATACACAAAAAGAAACCGCTCCTTTGAAGCCGACCCCTAGCGG
CTCGTCTGACAGCGGGTATTTTTGGTAAATTACAGAAATAGATCTGGCACAAAATTGACACGAAACTGGGCTTGATACTGTGCAGGACGCTACGCTGCTA
GACGAAACCGAGAGGAAAACGTCCTGCACGCGCTGGACGCGAAGCACCAGTCGTCTTGGCCGTTTGCTCGCCGGTGCCAGTCGACCGCGGATAATAGCCA
GCGACTGACGTGTGCGTGCTCAAAATCCGAGAAAGAACCTGAACGGAGCGATCGGACTATGCACTGCGACACCGGCAGGAAGAGACAACACGATAGGGCG
AAACAGCGTCGCCTCGGGCTAATCCAATGTTCGCAGCCAGATGTACCGGTCGTCACCGCCATACGCGACGCCACTTTGCAGTGGGGGCAGCCGAAGCCCT
GCAGGCACTCAGCTGCTGGCGAGGGGGACTATCTACCGCAGGCGCCGCATGCCGCGAGATCAGAAAAGCTGCTGGCCAAGCAAGCGCTTGATTAGGGCCC
AGCAGCAGGCATCCTGTTGAGACCAAGCAGGCACTCGGACGTCGTGTGTTTGGAGGGTAATGCGCGGCATTTCTACCCGGTCAGAAAGCCGAGGGTCTCC
CTCGCTCGATACTCGACGCTGACCACATTCCTGTTTGTGGCGGAAGGTGTTCGCTGCATCGCGAGCAAGATCAGGTTGTATCATTGCCTCGCTCTGTGTA
CATGTACATAGATTCACTGCGAGTGGTGATCTCCACTTTCAACGAGATCACGTTGCCAAAAAAAATAGGGAGCATGGGCCGTTGCCAACGACCATCGGAA
GCCACGCAGACATATCGGTTGCTGGCCACCCTCGTCCGATACGTAACTGGCCTTGGACATGCAAGTCATGGGCAGTGCTGGGCACGGCCGGCAGTGCGCT
GGGCAAGTGCGATGCGACTGTCCCGAGATCGGCGGTACGGTGCGTGCTTGGGATTTGAGACGGAGTCGACGCCATCCTTATGCACTCCCAGTCATCTGCA
CAGGTCCCGCCGTTCGGTCGGCCTGTCAAAGGAGTCATGACTCATGTGGAGGCAACTTCAACTATCGCCCCGAAGCTTGGATGCTCTATTTCATTTCGCT
TTGGTGTTCGCGCTACGGTAGGCAAACTATTAGAACGGACCTTCTCGTTCAAACATGGCGGGAGGCGAGACGACGGGAGGCAACGTAGGTGCCTTGGCCG
GTATCAAGTGGCGAAGGATCTGCTCCAGCTTCTGGTCAAGCTCGTTCATCCTCGCCTCCATCTTCTGCTCGACTAAGCGCACCTGGCCCTCAAGCTGCTG
CAACTGCAGCGGAGTGCCGGTACTGCTAGCACTAGCGTGTTGCGATCTTCGATCGGGTATCCCCAACGCACCGCTCATGGCTGGCGAACCTGACTCGGGA
AGTGTTTTGCTCTCGTCGGTTGCAGTGTCTTCCGTGATGGGATTCAGCGAGACCGTTTTCTCCGAATGCGAGGTCACTGCGCCAGAGGAGGCGACGGAGG
CGGCAACAGCGGCAGCGGCAGCCACGATGCCATTCGCTATTCGCCCGTTTCCTTGACCTCCACGGACTTCTGGCGGTGCTACAGCTCCCGCCACGCTGAG
AAGGTTCGACAACCGCGGACGGAAGTTTGCAAGGACTCGCGTTTTGTTCCGCAGCTTGTCCATGTTCTTGTAGGCCTGAATGGTCTTCTTCATCTTGGCG
TCGGCGAGCGCCGTCATCTTTTCCATGCGCTCGGGGCCGTCGTCCTTCCACATTTCGCCCACGCGCTTCACGATGAGCTTCTTCATGGCGGTCGCGAACT
CGGGGAACTCGACCAAGATTTTGTCAAAGCCTTCCCGGGCGAGAACGCATAGCTCAGCCATGCACTCTGCCTTCACACTTCGTGTGCGCTCGACCTCCAT
GACCACTCCGATCTCGCCAAAGAAATCGCCCTCGCTGAGCAGGATGATCGTTTCGGTCTCGGGCTTCTTGCAGCCTTTTGGTGGAAGCACGCGCACGATA
CCTTTCACAATCATGAACAGCTCCTTGCCGATTTCTCCTTCGGTGATGATGTAGTCGTCCGGCATGTAGATAACTTGGTGAAGCTGCATGCAGATCATGC
CCAATACCGCGTCCGTGGCTAGCTGGAAGAACGGAATCTTCTGCAGGTTGTCTTTGAAAAGGTAGATGGCTACTTGGCGGCGCAGCGTCAACGACATGCC
CGGGTCGTGCAGCAAATTCAATTGCTCCGACAGAGCACGATTCTGCGGATGGATTGCAATTGCAGCAGCAAAGGTCAGTAAACGATCGGGGGAGGCGTGG
TCGCAAGATGAACGTACGTTGAGCCAGAGGTAGTCATAGTAAGCTGTCACCCGTGCCTGCAGCAAACCCAAACAACCGTCGGTCAGTGAACCAAGTTAGC
GGCTTGTATGAGGTACAACAAGAATATTACGGACCCGCAACGACTTGGGTAAGCTCAACGCGTCCATCTCGTGAGTGACATGGTCCATTTTCTTACGAAA
CGCGTTCTCAGCCCTGTTCCAGCTATCGTTCCACAAACAATTGTTAGTTGCCTGGACTTTCACAGGACAAACTGTTTCAAATACCTTTGGACGAGGTTGA
TAATGGTGCCAAACACTATGGAGGTCAAAATGACGCCGTACACGGATACTCCACTGGACCACAGATAGATAGCACTGTTCAAGTCGTCACTGGGTGAATG
ATTGTACCCCCCACTGAGAAAGCGGTCG