Description :
From Genome Similarity Track
Location :
Scaffold_9:378289- 382193
Transcript NameFunction/comments
Hyaar_Emoy2801813hypothetical protein
Hyaar_Emoy2801814hypothetical protein

Sequence
3904 bases(100 bases per row)
AGGGCTTAGCACCAAAAGGTTCCATACCTATTAATATGGAGCGTGGATACAAGGCTGGCTTGTTGGTCGCTGAGGCGAAAGTTAAAGGCTCTGAAAAACC
TTGGTCGATTTTAATCAATTCGGGAGCGTCTTGCAATTATGCTCGACGTCGTTCCCTTGAAGGAAGTCAGCTGTATGCTGAAGAGCTTACAGCGCATGAG
GGTGATTCCATCACGGTTCGTTTAGCGACTGGAAGTCGTGTCACTGTACCTAAAGTTCCTTTGAACTTAGGTATAAAGTTTTTGGACTTTGATAGCATTG
AACGCCGTCTTGTCCTTGATTTGGACTCGAGATATGATCTCATCCTAGGTATGGCTTGTCTTGAACGCCATGAGACATGGATTGATTGGAGGTCTAGGAC
CTTAGGCGCTACGCGCAATGTTCCTAGCGAAGCTTTGGAGAGTCATGAACCCACCTTTACTAGGCAACAAAAGCACTATTGGCGCGAGCCTTTAACAGAA
GATGTCAATGTGCTGGACATTGGAATGTCTTAGTTAACTAACTCCAATGTTGAAAACATGAATTCCGAGCGTAGCTCGTTGAATAGTAGTGATACGACAC
GTACTCCGTTGAGTGTTACTCGTTGTGATAACGAGTCACTGCATGCTGAAAGCATGGTTGGCCTAGGGAAGAGTTATCAAGGATGTGATTCCTTTGATGT
TTGTGGGGTGACACGTAAAAATTCACCGAGTGCGGTCGGCCGTGAAGGCACCACACTCGATGTCGGTAATGACATCAGCTCTCGTATAGAGCGTACTACT
AGTAGTAGTAACCACGGGGACACTATTGTCCCGACCCCAGAGGGGTGTAAGGTCTTATCGAAGAAACGACCGGGACGCCAGGTGGCAACTGTTAAGCGCC
AGGCTTCTGTGCAGTCACCTAGTGACAATAGTGATACACTATACACACTTGTCAATAGAGTGACTGGCCAGGTTGAGGGCAATGTTAGCCTGGAAACCCT
TCCATCTTTAGATGCTCTTTGTGAGCTAGACGAAATGTCTGATGGAGAGTTTATCCAGGCCTTGAAGGCAGGAGATTTATCCGAATTAGTGGTCATTAGA
CCCGATGTTGAGTTGAACTCGTCCTCAGTAATGGATGAGTCGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCCGGAGTGGATCTTCGATCCTTAAAG
ATCCTTTGGTAGAGGAATTTCAAGATGTGTGGTGTCACCATCCACCATCTGTCTTACCTCCCGATAGAGGTGTACGTCATGAAATTGACCTAGTTCCAGG
GACTAAATACTGCGTAACACGGCAGTGGCCTTTACCTAAGGAACAGTGTGACGTCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGGAATAGTGCGG
GAGAGTAAGTCTCCCCATTACACACCTACTTTTTGTGTCAAAAAGCCTAATGGTAAGTGGCGTGTTGTGCACTCTTATAATAAGCTTAATGCTGCCACTA
TCCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAGTATGGTGGGATGTACATTGTACAATGCGCTCGACTCAGTCGATGGTTATTGCCA
GCTGCTCATGTGAACAAGCGATATTCCGCTAACAGCGGTTAGTACCCGAGCGGTATGCTCTGGGAGTGGCTCGTATGCCACAAGGGCTGTCAAATGCCCC
GGCTACTTTTAATCGTCTGGTGAAGCAACTATTCAGACCTCATCGAGGCTAAGCACAAACGTACTTTGATGACATCTTTGCCCATAGTCGTGCAACGAAC
GGTCGATCTGATGTGGATAATCACCATTGATCATTTAAGAGCGGTGCTCGAGTACATGCGCACGAATAAATTGTATGCAAATGCATCTAAGTCCATCTTT
GGTGCAGAAGAGATTCCCTTTCTGGGGTGCTTCATTAGGAAGCGAGGCCTTCGAGCGGACCTGCCAAGATAAGGGCCATAGTCGATTGGCCGGTTCCAAA
GAATCAAAAAGATCTACGTAAGTGGCTTGGCCTTACCAATTACTTGCATAAGTACAGTGAGAATTATGCAGACATGGCTCGGCCAATTGGTGTTGGGGTG
ACACCGAACATGAAGCTTTTCAAGCAGTTAAAGAAAGTCTCCTTCATGCGCCAATACTGGCTTTGCCCGATCCTGATCGGCCTTTCAGTGTCGTCTGTGA
CGCATCTGAATTTGCCATAGGCAGTGCTCTGTTACAAACAGATGTCGATGGACGCGAACGCGTCATAGCATTCAAATCTCGATAGATCAAAGCTGCTGAA
AAGAACTATCCAGTTCATGAAAAAGAGCTACCTGCTATGAAGTACGCTTTAGTCAAATTCAGAGTACATCTGCTTGGATCAAAGCCATTTGTGATCTATA
CATATCATGTGTCATTGCGCACTGCGACACAGTCGCCGCATCTCTCTCATAGAATGGCTCGTTGGCTTTCATTCTTTGCCGAATATATATTCGAATTAAG
TATAAGCCAGGTAAGCAAAATGCTTTGGCTGACACGCTATCGCGCCGACCTGATTATGAGCTTGCTCACGTCACTACGCTGTCATCGTTAGTCACTGAAT
TAATCTGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTTCGCTACGTGCTCTTGGGAACGAAGAGTTTAAAGACTCGGACATAGAATTTCGGCACGT
TTACGTGTGAGGCTACATCGATATTATATCGATAGTGGCCTGTTGTGCTATCGCACAGATATTGAGGATAACTCTCGTATCGCTGTCCCTCATGATGAGG
AGTTGAAGTATCAATACTCTATGAGGCACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGACTTATTGGTGG
CCCAAACTATACAAGTGGGTGAGCACCTATGTGTGTACGTGTGAAACGGGTGAACGGGTGAAACCTCAGCACATGCGGCGGCGCCGCTGGCTAGTCTGCC
TGTATCCACTGGGTATTGGGAGTCCATGAGTATAGACTTTGTGTTTGGCTTACCGAAAGATTCGGAAGGCAACACTGGCATTGTGGTCTTTGTTGATCGA
TTTAGCAAGATGGCTCATCTAGCGGCAGTGCCGGACTGTATTGATGCCGAAGGTACAGCGAAGCTGTTTATCGACCGTGTGTTTCGACAACATGGTTTGT
CAGTGGCAATTGTCTCTGATAGAGATCCCCGCTTTACTGGGAAGTTTTGTCCATCTTCAAGGTTCTCGGCACCCGTTTGAATATTTCCACAGCGGATCAT
CCGCAGACCGATGGTCAAACTGAGCGTGTTGATCGCGTCATTAATGACACTTTGCGCAGTGTTTGCGCTGATACGACTGTGCGTTGGAGCTCCATGCTCC
CTGTTGTTGAATTTACGTTGAACAACGCGGTTCATACCTCCACAGGCTATGCTCCGTTCTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAACACT
ATCACTATGTGGTTCAGGGCTTGGTGCGGGAGAGGTTGCCGATCGGCTTGCTGATATCATCTCTGCTATTGTTCAAAAACAGGTAGGCGAGTTTCTCGCA
ACACGACTGAATGTATTAAGACATGTGCGTGACGCAATGACTGAAAACCAAGACCAACAAAAACAACAAGCAGATGCTAAAAACAGAGGTTGTATTGAAC
GTTATCAGGTCGGAGACCAAGTATTACTTAATGCTAAAAACCTACCTACAAACGTAGTGTCCGCTGTCTTCAAGACAAAGTTGCGTCCGCGCTTCATTGG
ACCATTCACGATCGTTGATAAGAAGGGGATACGCTCAACCTTCCACGCAAATTGCGCACACTTCCGGTGTTCTACGTTGGCTTGCTTAAGCGGTATCGGG
ATCC