Description :
From Genome Similarity Track
Location :
Scaffold_158:37817- 43644
Sequence
5827 bases(100 bases per row)
GGGCCAATCTGATGCTGTGAGTCAGCTCGACCGCGTAACGTGTGAGTTGGGCGAGTACCTCGAACACGAGAGAGGCAGGCGTCCGAATTTGCTTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATGAAAGCGAAAGACCGTGTCAATAAAGACACGAGAACAAGTCGATGCGTTTATGGTTTC
AGGTACAGCAACCAGATGTTCATTTGCTTAATCTGTCAGCGAACACAAGAATACCAGTATCTTGTGTGGGTCTGCCGGGAATGCGAAGACGAAGTCCATT
GAAACAGATTCTCAGCACTCTGCCGGGACAAACAGAGGCTGCAATGGGGCACGAAGGGAAGGACTAGATTTCACCCGTTGACAGACCTCACAGGCCCGAA
CGTTTTTGTGCACGAACTGATAATGGCGAGACCAGTAAATGTCGCGGCTCACTGTGAGATATGTTTCTCACGACCACGATGTGCACCAAAAGATGCGTCG
TGGTAATCATAAATGATACGCAATCGCAGATCACCTTGATCTGGTACGACGACACGAGGAAGGTCGCCGACAACAGATGAATATTGGAGTAAGCCGTTGC
GAACTGTATATTTATCCTTAGAGGATCGATATACTGACGAAAACTGTTCGAGGCTCTTCCCAAAACGTTACGAGAGATCATGCATCAATCGAACAATCTC
CGGATCATACTCCTTCGTATGTATTCCAATTAGGTTGTCGACGGGACACTCGAAGTCAATACCACGACAGCGGTTGGAACAGTATCGGATGGCGCAGCCG
GTTCGAAGTCGAGACAGCGCGAGAGTGCATCAGCTACGACATTAAGACGTCCTGACTTATACTCGACGGAGAAGTTATACTCCGCGAAGAATGACAACCA
CCTCACCATCCGCTGCAAGAGGTGAGGACTGCTTACAGCTGTGCATAAAGACGCATGGTCCGTATAGACTATAAAGGGTCTATCGCCTAGCAGATAGACT
TGGAATATCTCCAACGCGTACTATATGGCAAGGCGTTCCTTGTCACGGAAGGGGTAGTTGCTTTCTGCTGGTTGCAGCTGGTGTGACTGATAGCGGACGA
CACATTCCGCTTCGTCTGCATCGTACTGCATTATTGCACAGAAGATTGCAAAGTCACTGGCATCACAGACCACATGGAATGGCCTGTTTGGTCTGCAATT
GCCAATACTGGCGATCGTATCAAGCTTGGCTTGATACCTTCGAAGGAGCTCTGACAATCGGCACTCCATACCCAATTCTATTCTTTTTCAATAAACGAGA
GAGATGAACAGTAATCTCGGCGTAATTAGGGAATATTTGTGCAAATACGCCGCCAGGCCAAAGAACTTTCGAAGTCCCTTGACATCTGTAGGCACCACCA
GGCTGTGATCGTAATCGCTTGGATCTTTTCCGTATCTGGCAGGACGCCATGCTTACCCACGATGCAACCAAGAAGTGGTTTTACGCTGGCGGCAAATATA
CACTTCTTGATGTTGGCGTACAGCTTATGCTCGCGCATAAGCACAAGAGCCTTCCGGAAGTGGAGTCGGTGCACTTTCAAATCTGTCTGTCCGTCCAAAT
CCCGGCTATGGGGGAACACATCATTGAATTAGCTGCGCGCGAATGCATGTACAAATCTCAACAGATTCATCACACATCTGTTGAATGTAGCAGGGGTGTT
ATTTAGCTCTTGTGGATTACTATCCACTCCCAAAGCATACCGCTTGGGGTGCTCACTGCAGTATAGGGAATGTCCCTTTTGAGCATAAGAATCTGATAGA
ATCCGTCCATCAGATCTATTGATGAAAAGATGGTAATCTTAGCCATACCATCTATGATGACATCTTTCCTTGGTATTGGTGCTTGAGCCGGTTCAGTTGC
AGCATTCAACTTGTTGAAGGCGTATACTATCCACCACCCTCCTGTGGCCTTTCGCACACAGAAGGTGTGAGAGCTATGTGAAGAGGTGGACTCCCTCACA
TGGCCGGCTGCTAAGCTATCTATAATGAAGTTGTCGATCGCTAGTACTTGTTCACGAGGCAGTGGCCATTATTTCATGACACACTACTTCGAACCCGGTT
TCAGGTTGATTTCGTGACGAGTACCTTTGTCCTTAGGTAACTCGCACGGGACTGCTTCTGGGAATACATCCCTAAAATTCATCAAATCATCGTAGAGAGA
ATTTGTTCTGAGCTATTCCCACGAGTGGGATGTATATCGCTCAATTCGAGTCTTCCCATCAAGAACACCCTCGTTCATTAATGAGCTACTGACAACTCTT
TCATCCTCGGCAAAGATCATTGCCGATCGGATATCACTGAGGTACTCATCCTCCGCGACGAGTACGCAGATCTGCTTGACTTTGCCACTACGCAGATCAC
GCAAGAACCTCTTTTGGTTCAGCGGGGGTAACTGATTAATCTCCAAAGTTAACTTCGGAGGCGCGATCAGATCAAGTGTCTAACTACCTATTCTTGATCC
GTCATTAACCAGGACATTCAATGTCTC