Description :
From Genome Similarity Track
Location :
Scaffold_177:37805- 43180
Sequence
5375 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTCGTAGTCCGTTCAACGACCATGAACATGTTGGACGATGAGGGGGATGATTTTCATCCCACGCATGAAAGCTACTCCCA
TTTGAGTGAAATCGAATGGGATGCCGTCGAATGCTTGAGTTCAACGATAGGGCAAGAAGCCGTTGGCGCACTGCTGTCTACCCTGGAGCTAGCACGCCAC
CATCGCCAAGTTCATTCAGAATGAACTTGACGTCGAGCGGGAAAAAAACCTTGCGTCACCAGCAAGGTTATCAACAGACAGAGCTGTTGAGACAGCAGCA
GGCCACTGCTACCGGGTCAACGTGTACACGTCGATCCGAGACTCTAAAGATTGACATCTCAAAGTACAAGGGAGCCGATGAAGACTCTCTGTTGAGATGG
TTCGTGGTACTAGACGATGCCATAAGGGCTCGTCATATCGTCGATGAGGAAATGCAGATCGCATTTGCTCAATCGAACTTGGCAGGGCGTGCAAAGACGT
GGGCCTCGGGCCTTAAGTTACACGACCCATATGTCTTCGGGTCGTTGGAAGTCTTTAAGTCCCTGCTATGGCAAACTTTTGAGCCGCCGCGAGCTGAGTT
CAGGGCTCGCTCTGAACTCCTGAGAATCAAGCAAGGTAAACGTGACTTACACTCGTACATTCAGTACATATGCCACCTTACCAGTTGCATAACAGTCGAC
CCACTGGACCAGCAAACGTTGATTACGTTGTTCATGAAGGGTCTGATTGATGTTCCTGTTAAAACCTACCTGTTTCGATTGGAGTTCAACACCCTTGAAG
AGGCAATAAGGGTTGCGGAACAGGAGGAATTCAGCGTGAAAAAGGCTCACGCGAGTTCGAATTCCTATCACCCATCGAGACGACAGGAAAATTGAGGCCC
AGAATTAATGGACCTCTGTAACGCGAGGAGCGAAAGCTCTCGTGTTAATAACTATAAGAAATTGCAGAAATGCAATGGATGTCAGAAGACAGGACATTAC
GCATATGTATGTAGTTCCCCGAGCGCGTTACCACGTACCGCAGGAAACAGTAACCGCCAAGCGGCCAAGAGAGGTCCAAGGCGTGGGTCCGACGTTGTTA
CGAATACGCAACAACGTAACGGACAACCAAAATACGGCCAGGGTTAGTAGGTGCGGGGCACCCTACTGATCCAGCAACGTCAAGTGAGTTTTCAGGCCTC
TTGATGGAAGTTGCTCCCAACACTCAGTCATTGTGTGTTGATGCTTCTGGTAATGAGGTTTCACTCATTACCAGAAGCAGCAACACACAATGAGGTTTCC
CTCATTACCTTAAAACTCGAAGTGACACAAGGCATGTCGCTTCGAGCTCTAGTCGATTGTGGGTAGTCGAACAACTTTGTACGACGCCAATCGCTAGACA
AAAGAGAGCTCGAATATGTTGAGCGAGAGATCCCTCCAACGAGGATGACGGTGCGCCTCGCGACAGGCGCATCCGTAACAGTGATGAAACGTGTAGTGGG
TATTACCTATACACTAAAGGGAGTCCAATACGATGATGACTTCATCATATTAGACTTGGATGACAAATTTGATGTTATCCTTGGACTGCCGTGGCTCAGA
AGGTACGAGCCACAAGTCAGCTGGCATCGACGAACAGCCGATATGCCTATCACTTGTTCATCAGATGGCCATCTGATGAACGCCATGGAGCGCCCACTAA
CATGTGGGTGTACTACGAGCGAGTGCGATGGCCTAGCGCGTGGTTCGGTCGTTAGCACGACTGCACATGGCCATGGAGTGGCTGATCTCCACACCATGAA
GTCAGATTCCGGCGACTGCATTGAGATGCAGATCGCGCCGAAGGCCCACCACCCGAATAAGTCGAGTGGACTGGGGTATGGGTGTCCTCCAAACGGACAA
CACCCAAGTGAAAATGAACCGATTGCCAATGATTGGCAATACGATGATCTTAGTGCGATTGGAGAATCAAACGTAGAAGACCTGGCTGTGGTAGCGCAAC
CACCTCCAGAAGATAGCGAGGGAGCAATTCCACTCGTGTCAGATGATGAGATAGCCCAAGAGGCTAGTGAGGTAATCAATCCCCACCCAACTGTGTAAAT
AAGTTTCCAGGAGACAATAGAGACATTAAATGTCCTAGTCAATAACGGATCAAGTATAGGAACTTACTAACTTGATCTGATCGCGCCTCCGAAGACAACT
TCGGAGATCATTCAATTTCCTACGCTCGAACAGAAAAGGTTCTTGCGTGATCTGCGTAGGGGCAAAGTCAAGCGGATTTGCGTACTCGTCGCGGAAGACG
AGTACGTAACCGATTTTCGGTCGGCAATGGTATTCGCTGAGGACGAAAGGGTTCTCAGCAGCTTATCAATGGACGAAAGTGTCCTTGATGAGAAGACTCG
GATTGAGCGATATACATCCCAATCGTGGGAATCGCTCAAGACAAATCCTCTCTACGATGATTTGACAGAATTCAAGGATGTGTTCCCAGAAACAGTGCCG
TGCGAGCTACCCAAGTTTAAGGGTAATCGTCACGAGATAGACCTGAAACCAGGTTCAAAGTACTGTGTCATGAACAATGGCCATTGCCTCATAAACAAGT
ACTAGCGATTGACAAATTTTTGCCGATCGCTTGGCAGCGGGCCATGTGAGGGAATCTACTTCCTCACATAGCTCTCCGACCTTCTGTGTTCCAAAGGCCA
CAGAAGGATGGAGGATAGTACATGCCTTCACCAAGTTGAATGCTGCAACTGTACCGGCTCAAACGCCGATACCAAGAAAGGATGTCATTATAAATGGTAT
GGCAAGGAGTACCATCTTTTCATCGATGGATCTGATGGACGGATTCTATCAGATTCTTATGCGTGAAAAGGACATTCCGTACACAGCATAAAGCACCCCA
AGCGGTATGCTTTGGGAGTGGTTAGTAATTCCACAAGGGCTAAGTAATGCCCCTGCTACGTTCAACAGATGTGTTACAAATCTGTTGAGATCTGTGCGAG
AATTTGCACCCAGCTATTTTGATGACGTGTTCGTCCATAGCCGGGCTATGGATGGGCAGACGGATTTGGAAGTCCACCGACTCTACGTCCGGAAAGTTCT
TACACTGAAGCGTGGGCATAAGTTTTATGCCAATCTCATGAAGTGTATATTTGCTGCAAGCGAAATACCACTTCTTGGATGCATCGTGGGTAAGCACGGC
GTCCGGTCCAATCCGGAAAAGATCAAGGCGATCACTGACTGACCGGTGCCTACCGATATAAAAGGACTTCAAAAGTTCCTTGGCCTAGCGGCGTATTTGC
ACAAATACTCGCACAATTACGCCGAGATGACTGTTTATCTCTCTCGCTTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTGTCAGTGCTCATT
TGAAGGTATCAAGCAAAGATTGATAAGCTCGCCAGTTTTGGCGATTGCAGACCAAGACAGACCATTTCATGTGGTCTGAGATGCATGTGATTTTGCCATC
GGATGTGCACTAATACAGTACGACAAAGACGGTGCTGAGCGTGTCGTCTGCTATCAGTCACGTCAGCTGCAACCGGCTGAACGTAACTACCCAGTCCATG
ACAAGGAACTCCTTGCCATGAAGTATGCTTTGGCAATTCAGGTTCTATCTACTAGGCGATAGACCCTTCATCGTTTACACGGACCATGCGTCCTTACGCA
CGGCCGTTAACAGTCCACACCTCTCGCAACGAATGGCGAGGTGGCTGTCGTTCTTCGCGGAGTATAACTTCTCCGTAGAATATGAGCCAGGACGAATGAA
TGTCGTCGCTGATGCTCTATCGCGCCGGCCCGATTTCGAACCGGCTGCGCGACCCGACACTGGTCCTACCACTGTCGCGGTGTTGACGTCGAGTGTCCCG
TCGTCAACCATATTCGAAGACATACGCAAGGCGACGATCCGGCGATGGTGCGTTTGATGGATCATCTCTCGCAACCATCCCGTCAATCCCTTAAAGGTTG
CCCCCAGTATATCGATCCTCCACGGATAGATGTACAGTCCACAATGGCTTACTGAAGTATACAGCCGTTACCGGCAACACGCCTCGTGTCGTCGTACCGG
ACCATGGTGACCTGCGACTGCGCATCATGTATGAGTACCACGATGCACCTACTGGTAGACATCGTGGTTGAGAGAAGATATATCTCACATTTAGTTGCGA
CTTTTACTGGCCCCGCCAGTATCAGTTCGTGCGAACGTACGTCCGCGCATGCAAAGTATGTCAACGAGTGAAGACAGGTCCTTCAATTCGTGCGCCGTTG
CAACCCTTGCCCATTCCGGCAGAATGCTGGGAATCAGTCTCAATGGACTTTGTCTTTGAATTCCCCGCAGACCCACACAAGAATACAGGTATTCTTGTGT
TCGTTGATAGATTCAGTAAAATGGTACACCTGGTCGCTGTACCTGAACCTATCAATGCATCGGTATGTGTTCGTGTCTTTACTGACACGATTCATGGGTT
GCCTCGTGAACTCGTCTCTGACCGAGACCCACGGTTCACTGCGGAATTCTGGCGATCCGTGTTCAAAACACTCGGAACGCGCCTTCAGATGTCGACCTCT
GACCATCCTGAAACAGATGGTCAGACAGAACGTGCAAACCGCTTTCTTGAGGAAATCCTTCGGGGTTATGTCCATTCGTTTACGAATGGAGCGAATGCTT
GCCAATGGTGGAATTCGCCATCAACAACTCGGTGTATGCATCGACGACGCATACACCGTTCTTCGTGAATGGCTTGCGCCACCCACGCCTACCCACCTTC
TTAGAGTGTAACTCTAGTTTGAGGGGGGGAGGGACTCATTCGAGCGAACGCCAAGTCGGCTCTCACTCATCACGTACTGACCACGAGGTCACTACGTATG
ACGCCGATGTCGATCACATCGACTTCAGTGAAGAAGAGGAATGTAAGAGCGAGGATGCTCTTACTACCCAGGTCACTGATCTTGCCACAGTACGCTCCAA
GCGCACTACAGCCAAAGACAGCGAATAAGCAGATGAATTCATGCTGGCTCGCGAAACGGTTGTCCGTTTCGTGCAAGATTCTATTGCTGAAGCAGTGGAC
CGACAAAAGAAAAACGCAGCCAAGAATGGAAGGGTAAATGTTCTTTCATTCAATGAAGGTGACCTAGTCCTACTATCTACGTTAAACTTACCTCGACACA
TAGTGACTAACGTGGGTAGTAACAAGTTACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCCGCATATGCAACGCATACACGATTGAACTGCCACG
TAAGATGCGCACGCATCCTACGTTCTACATCGGTCGCCTTAGACCTTATCACCAGTACGGGGCTTCTTCCGGTGA