Description :
From Genome Similarity Track
Location :
Scaffold_60:378036- 379253
Transcript NameFunction/comments
Phyin_T30-4PITG_17599Poly [ADP-ribose] polymerase%2C putative

Sequence
1217 bases(100 bases per row)
CATGGGTTTGCTCACTTTCCAATTCACCCCGTAGCAACAGCAAAATGGCTCCTCAACAACAAGACACCCAAAGCGCGGGTACGAGCACCACTGCGTCTTC
CATCGCGGAGAAGTCGGAGTCTGTTACTAAGCATAAGCCCATCAAGAACGCGCTCAATGATGAGGTCGAGCATTTCGAGTTCGACCACCCTGAACTTCGC
AGCGTTTTCCCCACCACCAAGCACGACCCAATTCCAGTGCTGCAGTACGAGGACCGAGGACTGATGGCCGACCCGACGTTCAAGAATTTGCTCAAGGATG
CCTCGGTGACGCAGTTGTCGCCGAGGATCGGCACGGAACTGTCGGGCATTCAACTGCATCAGTTGACGAACGCGCAGCGCGACGAGCTTGCTCTACTGGT
GTCACACCGCGGCGTGATCTTTTTCCGTGACCAGGAGATTAATATTGAGCAGCAGCTCGATCTTGGTCGGTACTACGGCCCACTGCACGTGCACCAGAAT
CTCGGTCACCCGGAAGGGCACCCTGTAGTGCTGGTGGTCGAGGACTCGGTGGGGGACAGTGACCGGATCATTCAACGCCAGCAGTACGACCCAGACAACG
TGTGGCACAGCGACGTTTCCAACGAGCGCCAACCTCCTTCGTACACAAGCTTCAAAGTGCTAACGAACCCTCCACTTGGAGGTGGCACGTTGTGGGCGTC
CGCATACGAGGCTTACGAGCGCCTCACACCGCCGTTTAAGACATTCATCGAGGGATTGACGGCGATTCACAGCAGCAAGGCCCAAGCCGAGCGAGCAGGG
AGACGTGGACACACGATTCGTCGAGCTCCGGTGGAGTTCGAGCACCCGGTTGTACGCACCCACCCGGTAACTGGTCGTAAGGCTCTATTTGTCAACCCCG
CGTTCACCAGACGCATCCCGCAGCTCTCTTCTCGCGAGTCAGGTACGACAAGCTTGTTGATCGCATAAGGTGCTACGCCTGCGTACTAACGATTGCATGT
ATCATGTTCAACTCCAGATGCGGTGCTCAAAGTTTTGTACAAGCACATCACGGAGGGCCACGAGTTCCAAGTTCGATTCCGCTGGACCAAAAATGCTGCT
GCGGTCTGGGATAATCACATCACGACTCACTTCGCGACGTTCGACTACTTACCAGGCAACCGACACGCGGTTCGAGTGACTACGCAAAAAGAGATCCCCT
ACTTGGACGGTGAAGCT