Description :
From Genome Similarity Track
Location :
contig_164:3780- 4981
Transcript NameFunction/comments
g14502.t1hypothetical protein

Sequence
1201 bases(100 bases per row)
TACTCGCCACGCAGTCGTTTTTGTCGTCCCAGGTGAAAAGCACTGACCCACGCATCGAGATACAGCGTCCCTGCAGCTTGGTGGCGAGGCTGTTACCTTC
CTCTCAGCGACCAGGTGAGGGAATACCGTCGTAGCGTGTCGGCAGAAATGGTGACAGTTGTAGTCGTGGTTGCCATCACCAAGTTCACCGAACCACCAAT
TTCCAGGCGCTCGAGCTGGATGTTGATATTGTCAAAGTAGACCGAGAACAGGCTCCAATTCTCCAGCAGTGCATCCACCCCGCAAATCGAGCCGTCGGTC
ACGTCCGGGGCCATAGCGTTTTGCAGAAAGCTCAGCACGAAGTCACGCAGCAATGGCGGAGGGGACCTGAGGCCAAAGCGGAAAATGCGGAAATACTGCA
TCGCCACAGTCCAGACTGTCTGTGTGGTGGGGATGCCGATGTGAGTGTTGCATCGCTTCAGCTCGAGTTCCTCGATCTCTTGTCGTAACTTTGAGTTAGC
GCTTTCGAGGGCGAGCGTCAACATGCGCTGCTTCTTCCGGTACCTCGCCTGGTTCACTCTGCGACGTTCTCACTGTACTCGAGTGTTTTGCTGGTGTTTG
CTGGTACTGGTAGCTTCGTTGGCCATGCAGGGTTTCGTGCAGGCTTGGAAGGGTGCTTGGGCATTCATGGCTTCCGGTGGCGTTTCAATCATGGCCACAG
CGGCGTGCCTGCGATTCGAGTTTGAGCGCTGAGTGACAGCGCAGATCACATTATCACTCAGCGACGTGGTGTTGGGCGGATATAGCGAGAAGACGGGCAT
GGCTAGCTTCAATGAAACTTTGATAATGATCGATGGTCGACTGAACCACACGAGGCGAAGGAGAGCAACAGCACCACCACGCGATTATGACGTCCAGGTG
TACGGATGAATACTAGTAATAAACAAGCATAACCTCACTGAGGTCGTAATCAGGCAGAGCATGAGTGATCCTGGACCGTGCTGATAACAACGCCGTGCGC
TCTGAAAATTTGAAGAGAGTGAGTACATATACTTCGAAGTGTACGATTATCATGCAAACGGAACATTCACGTGGTCACTGCCTTGCTGTCTTTTTAAAAG
ACCGACCCGACCACCACTATTAGCTAGCTGTACACCGAAGCTGTTGCTTGGCGAAGCTTATATGTTTGAGTTAACTGCTACGAAATGGAGTGTTTGAAGG
A