Description :
From Genome Similarity Track
Location :
contig_73:378- 3746
Transcript NameFunction/comments
g12231.t1hypothetical protein

Sequence
3368 bases(100 bases per row)
CCAGCGGATGACTCGCTGGCGTCATTTTACAAAGTCTACCAATCCCGGAAGACTGCTGGAAGTCGATGAGTCTCGGCTTCGTCTTTGGACTGCCGGCTGA
TGCCCAGGGCAACACCGGCGTCCTGGTGTTTGTTTGACGTTTGAGCAAGATGGTACACCTTGCTCCGGTAGCTGACTCGGTCACTGGGGAACAGCCTGCA
AGGCTGTTCCTGGATGGCTTCTTCCGCTATCATGGTCTCCCGGAGACTATTGTCCCTGACCGTGAACCAAGGTTCACGTCTGCCTTTTGGAAAACGCTGT
TCCAACTGCTTGGAACACGGCTGCTCATGTCCACAGCCGACCATCCGCAGACGGAAGGCCAGACGGAGCGTCAATCGCGTGCTCGTAGACACTATGCACA
GGATCTGTGTGGAATCTCCCCGCACATGGTCGGCCAGTTCGCGGGGCCTCGCACGGGGTTCACAACACGGGTCTGCACCCGTCCGGACAGTCGGTGGCTA
TCCTGCTATGGCACCCGCCAGCCTCGAACCCGACCCAGGAGGGCCTCCAAATCAACAACGCTGTGCATGCGTCGACGGGGCTCTCCCCACTCTACCTCAA
CGGGCTCCGGAACCCCCTGGTGCCACTCACTCTCCGTGGTGACGCCGTGGCTTCGGTCGTAAGTGGGGGAGAGGCTCAAAAAGCTGTTTCCTCTCAGGTA
TCAGAGGTGACACCGGCTTCCCTAAAGAAGCAGTTGTCGACTTTTGTCGACAACAGGCTTGATATGATTAGCCAGGTGCGGGACAAAGGAGTACTCCGAC
CGACATGGAAGAGGAAACTTAAACGTGTTTAAAGTGGGTGAGTTAGTCCTGCTCGACACTAGGAATCTACCACTAAACTCGGTCAGTTCCGCGCTCAGCA
AAAAGCTGAAGCACAGGTTTATCGGACCCTTTGAGGTCCTGAGCAGACATGGCTCCGCCTACACGATCGACTTACCGAAGTCGATGACGACCCACCCGAC
GTTTTATGTGGGTCGTCTGAAGCTCTACCACGACCCTCAGGCTTCTGATCCCCCGCAGGAAGCGAAAGGGGATTCTGAGGTGGCGAGTTCACCACCTCGA
ACTGGGCGCCCGCCTCTTGCTGTGGCGTCTGCCACGCGGAAGCCGGCGCAGGGGAATGGCTGTAGGCGTAAGCCTGCGGCCTCGAAGACGCCCCGCCGTA
CGGGTAGGAGCCGTAATGGTTCGGCTGGGAGTACGCACAGGACTGCGTCTCCCGATAGTCCGGATACCTCGGCCGGTTCTGAAACTCAGAACGGAGGTGA
GCCACCTCGTCGCGAAGACAGTCGACTTCGTACGACGACGCACGACGATCGACCCGAGAGTGGAGATCCTCACACTCCTGGCTCAACCGGGTCACATCTC
CACGAAGAAGGGAAAGGGACCCCGACTTGCCTGACCGAGCGTCAGCCAGCCCGCCAAGGTCGAGACCTAATGCCATCTACAGAGTGTACACTCGACCACG
GAAATCATGGATCTCCTGCTGCTGAAGCAGCACGGATTGATCAAGAGATCGCACCGACAATCTCGGATCCTCACGCTGTGGTGGAGTCTCGTACTCGTAA
CTGAGCGAGACCTCCTCCGGCTCTCCTTGACTGTAATGGAGAAACCCACTACCGCGTTGGAGCGTGTTCTCCGTGAGCGGCGCCGCCAAGGGAAGCGCCA
GCTCTTGGTGAAGTGGCGAGGTTACCCCTCGTCACAGAGCTCATGGGCGACGATCGAGCGGCTCCAGTCTGACAGCCCGAAGGCTGTCGCGATCTGGGAA
CAGAAGCGGCGGCAGTTTCGAAAGTAGTCGGCGGCCTCTTAGCCGACGGACGGGGTACGGTGGTGGACGCATGATTGCCGTACCCGCACTCGTTATGAGC
GCCGGACAGAGCTTCACGCTTTAGTCCTTCCATCTCGAAGTACAGCTTCCGCTTACTCACGAGATGGGCAAACTGAATTCGGAGGTCGCATTGATCCAGG
ATGCGATACAGCAAGCGATCCTCCTTGAGCTCCTTGAGCTCTTGGGCGGAATACCCGCGAAGGGCAACCCAGGTCCTCCGCTTGGGCTACGGTGTAAGTG
TTCTCGGGTTGGACTCAATGGTAGCCCTACACCGGGTGTAGATCACCCTTGTTCTCACCCTTCTTGCGAAGGATGATGAACGCCTTGAGTGGGATCCAAT
GCTGAGCCACGAGGACGCATCGAGCGGCCTCAACGTCCTCAGAGAACAGGTTCACCTTTTGAATCAAGGCGCTCTCATACGCGCCTCTTGAAATAGGGCC
TTCGATGAGGCCACGAATGGCACCGAGTCTCTCAAGGAACAACGGAGAACCTGTGTTCTCATCGGGCGGGAAATAGCCCCTGGGGAGCTTGGACTCCTCT
CCTCCTTGAGCAGTGTCACCAGGCTCCGGCTGTGGCGCTGAAGGCATGATGCATCCGGTCTTCCTGGAGGCGCTCCTGCTGCTCGTCAAGCGCATTGGAG
ACCTGCTCGGGGACGTGTACCTGTCCCTCCTTCTCCGATTCTGGCTCAGAGGAGTCAAACATGGCCTTGATGACATCAAGGATTCTTGCACAGCCCTTGG
GAAGGCGACGCGCTTCTTTGAGCCGGACTTTTTAGCCTTGGTATCACGTGTTTGCTGGAGGCCCTGGCCGATCGACAAGCGCTTCGTTGGCGACGCTGTC
TTAGCGTCACCGCCTTCTGGTCACTCGTGGAGCCGTCGCTCGTGGACATGGCATCCGCAGGAGACGTGGACATGTTGTCCCTGTCTCATTTAGGGTCCCC
GTGGACAGAGAACACGTCCTCAGACGCGCCTTTGTGGCTTGACCGATTTAGACTTCGCCCTCGCGGGCTTAGCCTTGGACGCTTTCGCGTCGCGAGGTGT
CTTACTCTGAGGCATCTTGCCAGGGCCGACGTGGAGGCCAGGGAGCATGTTTGGAGATGCCTAAGTGCTCCGGGAGAGCGAAGAGCGCGAGCGGAAATGA
TCGGCCTCTTGTCGATGGTTTTCGACTGAGCGAGAAAAGGGTGAGAAACTTCTCGCTCGCCCCGATTGGTCGATAAGATCGACTCTAAGGGGGGGGGGGG
ATGTAACGGGGTTACATGAAGAGTGCCCGTCACTCTTTCGAGTTGGGTACATGGTGTATTCAACAACACTGACACGTGGATGGTGGCTCACAGCCACTCA
TGCATACATATATAGGAGAAACTAACTATAAATATATCAATCTACAATCTACGTTGTTTAAGTTAATCGTTTCCCATGACCGGAAACCAGTGAACTGCCG
TTCACTTGGAATTTGTATACTCCTAACACTTCCTCGAGCGTAAGGTGCTGTGTGACTCCCGTCACAAT