Description :
From Genome Similarity Track
Location :
contig_73:378- 3745
Transcript NameFunction/comments
g9908.t1hypothetical protein PHYSODRAFT_339856

Sequence
3367 bases(100 bases per row)
CCAGCGGATGACTCGCTGGCGTCATTTTACAAAGTCTACCAATCCCGGAAGACTGCTGGAAGTCGATGAGTCTCGGCTTCGTCTTTGGACTGCCGGCTGA
TGCCCAGGGCAACACCGGCGTCCTGGTGTTTGTTTGACGTTTGAGCAAGATGGTACACCTTGCTCCGGTAGCTGACTCGGTCACTGGGAACAGCCTGCAA
GGCTGTTCCTGGATGGCTTCTTCCGCTATCATGGTCTCCCGGAGACTATTGTCCCTGACCGTGAACCAAGGTTCACGTCTGCCTTTTGGAAAACGCTGTT
CCAACTGCTTGGAACACGGCTGCTCATGTCCACAGCCGACCATCCGCAGACGGAAGGCCAGACGGAGCGTCAATCGCGTGCTCGTAGACACTATGCACAG
GATCTGTGTGGAATCTCCCCGCACATGGTCGGCCAGTTCGCGGGGCCTCGCACGGGGTTCACAACACGGGTCTGCACCCGTCCGGACAGTCGGTGGCTAT
CCTGCTATGGCACCCGCCAGCCTCGAACCCGACCCAGGAGGGCCTCCAAATCAACAACGCTGTGCATGCGTCGACGGGGCTCTCCCCACTCTACCTCAAC
GGGCTCCGGAACCCCCTGGTGCCACTCACTCTCCGTGGTGACGCCGTGGCTTCGGTCGTAAGTGGGGGAGAGGCTCAAAAAGCTGTTTCCTCTCAGGTAT
CAGAGGTGACACCGGCTTCCCTAAAGAAGCAGTTGTCGACTTTTGTCGACAACAGGCTTGATATGATTAGCCAGGTGCGGGACAAAGGAGTACTCCGACC
GACATGGAAGAGGAAACTTAAACGTGTTTAAAGTGGGTGAGTTAGTCCTGCTCGACACTAGGAATCTACCACTAAACTCGGTCAGTTCCGCGCTCAGCAA
AAAGCTGAAGCACAGGTTTATCGGACCCTTTGAGGTCCTGAGCAGACATGGCTCCGCCTACACGATCGACTTACCGAAGTCGATGACGACCCACCCGACG
TTTTATGTGGGTCGTCTGAAGCTCTACCACGACCCTCAGGCTTCTGATCCCCCGCAGGAAGCGAAAGGGGATTCTGAGGTGGCGAGTTCACCACCTCGAA
CTGGGCGCCCGCCTCTTGCTGTGGCGTCTGCCACGCGGAAGCCGGCGCAGGGGAATGGCTGTAGGCGTAAGCCTGCGGCCTCGAAGACGCCCCGCCGTAC
GGGTAGGAGCCGTAATGGTTCGGCTGGGAGTACGCACAGGACTGCGTCTCCCGATAGTCCGGATACCTCGGCCGGTTCTGAAACTCAGAACGGAGGTGAG
CCACCTCGTCGCGAAGACAGTCGACTTCGTACGACGACGCACGACGATCGACCCGAGAGTGGAGATCCTCACACTCCTGGCTCAACCGGGTCACATCTCC
ACGAAGAAGGGAAAGGGACCCCGACTTGCCTGACCGAGCGTCAGCCAGCCCGCCAAGGTCGAGACCTAATGCCATCTACAGAGTGTACACTCGACCACGG
AAATCATGGATCTCCTGCTGCTGAAGCAGCACGGATTGATCAAGAGATCGCACCGACAATCTCGGATCCTCACGCTGTGGTGGAGTCTCGTACTCGTAAC
TGAGCGAGACCTCCTCCGGCTCTCCTTGACTGTAATGGAGAAACCCACTACCGCGTTGGAGCGTGTTCTCCGTGAGCGGCGCCGCCAAGGGAAGCGCCAG
CTCTTGGTGAAGTGGCGAGGTTACCCCTCGTCACAGAGCTCATGGGCGACGATCGAGCGGCTCCAGTCTGACAGCCCGAAGGCTGTCGCGATCTGGGAAC
AGAAGCGGCGGCAGTTTCGAAAGTAGTCGGCGGCCTCTTAGCCGACGGACGGGGTACGGTGGTGGACGCATGATTGCCGTACCCGCACTCGTTATGAGCG
CCGGACAGAGCTTCACGCTTTAGTCCTTCCATCTCGAAGTACAGCTTCCGCTTACTCACGAGATGGGCAAACTGAATTCGGAGGTCGCATTGATCCAGGA
TGCGATACAGCAAGCGATCCTCCTTGATCTCCTTGAGCTCTTGGGCGGAATACCCGCGAAGGGCAACCCAGGTCCTCCGCTTGGGCTACGGTGTAAGTGT
TCTCGGGTTGGACTCAATGGTAGCCCTACACCGGGTGTAGATCACCCTTGTTCTCACCCTTCTTGCGAAGGATGATGAACGCCTTGAGTGGGATCCAATG
CTGAGCCACGAGGACGCATCGAGCGGCCTCAACGTCCTCAGAGAACAGGTTCACCTTTTGAATCAAGGCGCTCTCATACGCGCCTCTTGAAATAGGGCCT
TCGATGAGGCCACGAATGGCACCGAGTCTCTCAAGGAACAACGGAGAACCTGTGTTCTCATCGGGCGGGAAATAGCCCCTGGGGAGCTTGGACTCCTCTC
CTCCTTGAGCAGTGTCACCAGGCTCCGGCTGTGGCGCTGAAGGCATGATGCATCCGGTCTTCCTGGAGGCGCTCCTGCTGCTCGTCAAGCGCATTGGAGA
CCTGCTCGGGGACGTGTACCTGTCCCTCCTTCTCCGATTCTGGCTCAGAGGAGTCAAACATGGCCTTGATGACATCAAGGATTCTTGCACAGCCCTTGGG
AAGGCGACGCGCTTCTTTGAGCCGGACTTTTTAGCCTTGGTATCACGTGTTTGCTGGAGGCCCTGGCCGATCGACAAGCGCTTCGTTGGCGACGCTGTCT
TAGCGTCACCGCCTTCTGGTCACTCGTGGAGCCGTCGCTCGTGGACATGGCATCCGCAGGAGACGTGGACATGTTGTCCCTGTCTCATTTAGGGTCCCCG
TGGACAGAGAACACGTCCTCAGACGCGCCTTTGTGGCTTGACCGATTTAGACTTCGCCCTCGCGGGCTTAGCCTTGGACGCTTTCGCGTCGCGAGGTGTC
TTACTCTGAGGCATCTTGCCAGGGCCGACGTGGAGGCCAGGGAGCATGTTTGGAGATGCCTAAGTGCTCCGGGAGAGCGAAGAGCGCGAGCGGAAATGAT
CGGCCTCTTGTCGATGGTTTTCGACTGAGCGAGAAAAGGGTGAGAAACTTCTCGCTCGCCCCGATTGGTCGATAAGATCGACTCTAAGGGGGGGGGGGGA
TGTAACGGGGTTACATGAAGAGTGCCCGTCACTCTTTCGAGTTGGGTACATGGTGTATTCAACAACACTGACACGTGGATGGTGGCTCACAGCCACTCAT
GCATACATATATAGGAGAAACTAACTATAAATATATCAATCTACAATCTACGTTGTTTAAGTTAATCGTTTCCCATGACCGGAAACCAGTGAACTGCCGT
TCACTTGGAATTTGTATACTCCTAACACTTCCTCGAGCGTAAGGTGCTGTGTGACTCCCGTCACAAT