Description :
From Genome Similarity Track
Location :
Scaffold_1868:378- 3232
Transcript NameFunction/comments
Phypl_g14297hypothetical protein

Sequence
2854 bases(100 bases per row)
CGCGGATCTGAGACTGGATCTCGGATCTGAGACTGGATCCCGGTTCTGAGGCTGGATCGCTGATCCCGATGTGGATCTGAGTCCGTAGTCATTGTCGAAA
ACTAGTGACATCTCTTGCGCCACTCAGTCACATTCGATCCATCACCCGGAAATCCGCTTCTCCACAACCGCCTCCTGCGCACAGTTGTTGCCGCACAACG
GTATCACTGTGAGCACATTTCGCTTCTCTCTGCGTATCACATCCAAGACTCATGTCGGGCTCTGGTGGCAGCGCCTCCGTGGCAGGGTCTGGTCAAGGGA
CGTCCTCGCCGCCTCagtctcctccaccgtctccttCGCAAGCCTCGCCtgaagagctgcgtcgaGCGGTCCGCGGGCTCACGAACCGGGCGGCAGAGCT
GACAGAGGAGCTGAGAGTCTCCGATCTGGATCGTGACTCGGCTTTCCGCGGGCAGCACCGTGTGCAGACCATACTCTTGCAGCAGACGTACGATCTCCGA
GAGCTGGAGCGTTACTGCGATGGTCTCCGCGGTAATACCCAGCATCTCCAAGACGAGCTAGCCACGCGCCCTCCTGACGCCGGTCCTGACGTGCCAGATT
ATCTCGCTCAAGATCTTCAGCAAGTCGCGGATCGCAGGGTCCAGGatctggaggtggagctcgGCAGTCTTGCTCGTCAGCGAGATGATCTGGCTGCCAG
CAACGACCACTTGGCCCAAGAGCTGCATCTGGCTGCTCAAGAGATTTGTGACCTCCAGCAGGACCGATCCGCTGCGGATCGTGATCGTGAAGATATCGAG
CGTCAGTTCCAAGCTTCGGAGTCCAGTCTTTGCCATGTTCGAGAGGCCTTGCAGCGCGCCGAAGCAGATCTGGCCACTCGGCAAGCGCGATCACCTCAAG
CGGACACTTCGGATCGGGCAGTCGCGCCGACGTCTTCCGACATGGCGCAACTTACGGCCGATCGGGATCGGGCCCAGACTCAgttcgaggcggcggcccA
TGATCTGGAGATCGCTCGTGGGATCATACGAAGCATCTCTGACAAAGTAGCTCGGGAGCGCACTGCCCGAGCTGATGCCGATAGTCAGGCGGACGAGCTC
ACAACGCAGAACTCGTATCTTGGTACGTAAGCCTGCTCGATCTCTGTCCGAGGATTGTCAACTAATTTTCCGATTCTTGTTTCAGGTCAGGATCTCGATC
AGGCTCGACAGTCCCTGGCTGAGCGGGATCGGCAATACGCTCTCGTCACCGGTCAGCAtatgctgctgcagcactacCTTGCGGTGGTCCTTCGTGAGCG
AGATGCACTTCGCCGCGAATATTCGGTGGCTCTCAGTAAGCTATCCATCGTATCCACGGCGCTTGGCGCGCCTCCCATGCGCACCGCGCTGGTCCTCGAT
GAGGCTCCTCCGGGTGACTCGATGCAGCCCGTTGATCGCGCGGAGTCCCACCAGGCGCCTCCTGAAGAACACCCCAACCAGGATCCGCCTCCTGCTGAGA
CTGCAGATCCCGTTCCAGATCCTCTCCCTGCCGACGTTGTGGATCCGACGTTGGATTCCAACTCTTCCAAGCGATCGCGTCAAGGACCTTCGCCCCCGCC
GCGCCGACCGGTCAaacgacctgctcgtcggattgaggaggaagaagggGACGACTTCGACATGGGTGGCGCCTCGGCTGACGAGGAAGGATCGTCGGAT
CCGCCTGCCAAGTCCTCAGATCCTCCAGCCGGGGATCCGAACAGCGACGGCCCTGGTGATATTCCGCGGTTCCCGAAAGacaacgtcgacgacgccaagc
gtggcggtggcgccgAAGACGCTGGCAGCGATTGAGGTGACGGCGAGAGTTccggcgaagacgacgatgccgaagGAGACGATGATGCCGATGAAATCGC
CGACATTGCGTCCGATCTGTACAAGGACCAGAAGCGTCTCACCGTTATCCAGTCTAGGTCGGCCGCACGCCGTAAACGCTTGGCATCTTCTCCTGAACCG
GACGACACCAGCGGTGATCTCCCGTCCTCGCAGCCACGCCGATCTCAGGTGGATCCGGCTGGGCGCTCAGATCGCCGCcgatctgctgcagcccgcCTGC
CACCCAATGCGCCAATGCATCCCGTTGCCCCATTCGAGCCTGAGAGTGCGTGCATCCCTGGCCGCACGCGGCCTCGTCCCTTAGTTTCCGCTGACATAGA
TCCTTGGTTGGCAGCGGAGTTGTCGGATCGAGCCTTGGTAACCATGGCGATCGACGTGCTGTTCCCAATCCTCCCGTTCCGTGCTGGGTGGATCTTCCCT
GAGGCATCGGATGATCATCCCTCGCCCACATCGGCCGAGTTCTGTGAGGAGCTCATTACTCCCAACAACATTAAAGCTCTCATGGCAGCCGAGCCTTGGC
TAACGTTGCAGAATCCTGAGATCTGCATCAGCTTCGAGATCGACGTCGGTGGTCGCCTTGGGGCTTTCGTCGGTGGGTACCAGTCGAATGAGGACACTGA
TCTGATCACTTACTGGGGAGTCCACGCACTCGTTCCCGATCTCCAAGGCCCTCTGTATCAAGTTCCCGTGGCTTCTGGCATTCCGCAAGCAACGCAGCAA
CCGGCGATCTCACGCTGGCAATCGCTGGAAGAAGGTCTTGCAGATCTTGATCCAGGCGATGATCGAGGGCTGGTGTGATCTCGATCTTCTGCTGGATCCT
TTCTTCATGCATTTCCcccaagaagacggacgCTGTCGTCTGGTATCCAGGAATCGAAGCGCGTCGGGCGAATCTCGCCGATCCGCAGCTGCAACGCGTC
GAACCGGCCAGTCTGGTTGAAGCTCTAGTCGAGTGCGACGCGGCTGACCCATGG