Description :
From Genome Similarity Track
Location :
Scaffold_29:377884- 382077
Sequence
4193 bases(100 bases per row)
CACATCCTGATTGCTAGTGGTAACGCACTGCCGCCGCCAGCCTACGGAGCGGTATGCGATATCGACACACAGGGGCACGCCCCAATTAAACAGCGTGCCC
GGCGTGTGCCGCTGCGATTTCTCGGCAAGCTGTACGAGCTGCTGCGCGCTTTATTGCGTGCAGGACTGATCGTCTTTTCAGACAGTCCATGGGCATCGCC
GATCGTGATTGTGATGAAAAAGAACGGGCTGGACATCCGGCTCTGCATTGATTACAAGATGGTGAATGCATCACCGCGATCATGGAGTATGCAATGCCGC
TAGTCGACGACCTGTTAACAGATCTCGAGCGCTACCTATGGTTCTGCTCGCTGGATGCAGCAAGCGGCTTCTGGGCGGTCATGATGACCTTGCGAGCGCG
TAAAGTGTCAGCGTTCGTCTGCGCACTAGGACATTTTGAGTGGTTACGCATGCCCTTTGGGTTAAAGAACGCGCCGATGATCTATCAGCGTATGATTGAC
AACGCACTCTGGGGGTTCGTTCAACCTAAAGGAGGTTGGTTTGAATACTTGGAGAGGATGCGTTTAGCTGAAGAACAGGCCAAGGAACGTCGTGGGCCAA
GCGCCGAGGGTTCGTTTCAAACGAAGTTCGCGGCAGACCGCGAAGCACCGGTAGAGACCGACCCTGTACTCCAACTCGTCAACAGCCCCGTCGCTGACAT
GTTTACGAACGGGGAGCCAGACGAATCATCGCTGGTACCTGTATTTGGTCGACGGTCGTTTGTGGATGACATTTGCTTCGGTGGCGAGGATTTCGACAGC
TGCCTAGCGACGCTGGACCGATTGCTAGCAAGATTTGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTTTTGCCAACCCAAGGTGGACTTTC
TGTCGCATAAAATTTCGCCAGAAGGTATCAGAGCTGACCCCAAGAAGCTTGCGGCCATCACCGAGCTTTCGTTTCCAACGAGCAAGAAGGGCATGCAGTC
GTTTCTTGGAGCGGTTAATTACTACAGCCGCTTCATTCAAGACTTCGCAGTCTACGGTGCGGCGCTGTACCAGCTCAAGGATGAAGACTTTGTCGTTGAA
GGTGGCCTTTCTGTGGCACGTCGTTCCTTCAAAAAATTGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGAAGTTCACG
TCATGCTCTTTGCGAATGAATGGGCGTTGAGCACTACGCTAATGCAAGAACATGAAGGCAAGTTACACCCCGTACGGTTCCTCGGTCGGGTGCTCAAGGA
GGCCGAGATGAACTACTATTCTGCTGAGAAGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCCAGCTGGCAGGAAAGACGCTACATGTC
TATACACGATTCTCGATGTTAGAGTGGGTGCATAAGTCGAAGTCTCTATTCGGACGCGCGGTCCAGTTCGCAGTGCTGCTATCGCAGTGGCACCTTAAGG
TGCAGCGCGTGAAGGAGAAGGATGTCGCCTTTGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTTGACCTGGAAGACTCGCTCGCGCCGGTGGCGCC
TCCAAACAAGGGTTCCCCGACTATTCGAATGGACCCCGCGTTGCTGTACGCCAGGCTTTCCCGTAATTACAGCGGATTCGTCATGTCTTTTGACGGATCA
GCGAGGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAACGCTTACCTCTCGG
CTACCACGGTGAATGAGGCAGAGTATACAGGTATGATAAACGGTGTCAAGGCTGCTATTGCGCACGGTGCCGAGGATTTAGTCATCGTTGGTGACTCAAG
GCTCGCGATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGCTGCTGAATACTCACAAGGAACTCACGGCCAAGCTTCGATCA
GTTAAATATCTTCACGTTGTACGAGAATACAACGCGGCCGCGGATTCGTTAGCCACTGAAGCGCTGGAATCGAAGGTCAGTCGGGTAATCTTGGCTGAAA
CTCGCAAGTCGGAATTGGCATCGCTGAACCGCATCCAGAAAATGATCTACGAGCCGGATGAAGACTCGGTAGATGTTTCGTCACAAGGAGCAGAGCGTCA
AGTACATGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTTCGAAAATTTCGTGGTTGATTACAGCTCACCAAATTGCGATTATGGTAATATGGCA
GTGATGACTCGGCGACAGACGAAAGCCAGGAAACGCGTCAGGTTTGCAGATGAACACTCGGAGGATGTCTCAAAAGCTCAAGAACAGAATGAAGAACGAC
GAGAGACGTCCACCGAAGATTCAACCGGCCAGGATTTGCCAGACCATCCTCACAAGACTGTATCAGCGGCATTTCCCGATGCGGATAATGTTGACCCGGT
AGCGATACAGCGGGAGCGACGCAGACGGATACTAGTGGCACAAGACGAGGAACAGTAAGTGGTTTAACATCAAGAAGGTGCTTCAGGGCCAAGCACAAGA
GCTGAGTTACAAAGAAGCTCGAGATGCCTGGAAGTATGCTGACCGGTTCGTGTTATCAGAAGACGGCGTGCTTCACTATCTTGGATTGAATCGTCGGTAC
GACCACGGTTGGCAAGAGGAGACCAAGCTGCGGCTTGTGGTACCAACAACGATGATTCAAGAGGTCCTGCAAAACTGTCACGACTCGCTGGAAGGTGGAC
ATCAAGGTGTGGTGAGAACGTTCCATCGCGTTAAGTCCGAATATTATTGAATCGGCTTGTACGCGGACGTGGAGAAGCATGTGAAGTCATGTCCAGATTG
CAGCTCGAGTAAAAGCCGTCCGCAGCTTCGTGGATACTCACCTGGCAACGTGCTAGCCGAACGACCTTTCTGGATTTTGTGATCCCACTACCAAAATCCC
GCAGGGGCAACACGGCGTTGCTCCTATTTCAGTGCTCGTTCACGGGATTCGTTATTGCCAAGGCTATGTCGGATACGACTGCGCTGAGTGTTGCCCAAGT
GTTCGAAGAATGTGTGTACCGACGGTTCGGAGCCCCATCACTGATAAGGCACGACCGTGACCCACGCTTCATGAGCGAGGTGTTCCCAAGCATTTGCAGA
GATGATGCAGTCAAGAATCACGAGCGACTTTTGAGCTATCGGGCCACAGGCTAATGGACAGCAGGAACGCCTCGGGTGGAAGTCGGTGATGGATTCCGTA
CGGGTGTACGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGGATGCTCAGTCGACGTTAAGGGCAATG
TCGTCATCACTCAAACGAGGACTCGGTAAGCAGTCTGACGCACTGGCGTTGCGGCGTGAGATCAATCGACAACATGAGGTCGCCCTCACTATGGCCAAGG
ATTATCAGGCTGTAGAAAAGGAGCGAAGGGCTAAAAAGCATAATGATGCTCTGAGTCGACTGGAAAAAGCTGCTGTACCTCAACCAAGTGGAAACGAACA
CTCGGCGGAACCCCTAGAAGCTTCAGAAGAGATGGAAGATCCTGCAAGAGGATCACCGAGATCTCTTTTTAAATTGGGAGCCGGGCGTGGTTGTACATGG
AACGCGTCAAACCGGGCTTGACGAAGAAATTAGCTCACCGATGGCATGGACCTTTTCGGATCAAGCGCAAGGTGGAAGAGTTTGCGTACGAGCTGGAACT
GCCTGACCGAAGTGAGTATCGCTTCTACCCAGTAGTGCATGTGTCGAGACTCAAGGCTGTCAACGAGTTCAACAGTCGACCGAACACTCGGTTGGTACTA
GACGCGACTAATGAAGCAAGACTCGACTTCGATGAGGAACTACTGCCTGAGGACAGCTGGGAACCAGATCAAGTTGCCGGTGAATATGAAGTCGAGGCCA
TCCTCGACGACAGAACACCACTGACGACGAGCACGGAGCGTGCTGTACGCGAGTTCAAAGTCAAGTGGGTTGGCTATGAAGATACAACTTGGG