Description :
From Genome Similarity Track
Location :
Scaffold_14:377873- 379811
Transcript NameFunction/comments
Hyaar_Emoy2802664NADH dehydrogenase
Hyaar_Emoy2802665conserved unknown protein

Sequence
1938 bases(100 bases per row)
GGCTGCTGTCGCTCATTGATAAGTTCCGAAATACTGTTTATGCACCCTTTTAATTTGCTTGTTATGGAAATATCGCAGTCATCTAGTCGTTCCGAACTAG
ACTGAAGCTACCACCGAACACGAGCCCGCCGTCCAGTGTACCCCACAAAGCTTGCAGCCTGAAGGATCTCCATGTGTGTGTGCGTGTGTACATGTCTCTG
CTCAACGATAGAGCTGCTCGACCGAGAGGTTCTTGGCAATTTCAAACTCCCACTTGTCCCCATTGGCCAACAGCTTCGCCTTGTCGTACAGCAGCTCCTC
GTGCGTTTCCGTAGCAAACTCAAAGTTTGGGCCCTCCACAATCGCGTCCACCGGACACGCCTCCTGACAGAACCCGCAGTAAATGCACTTGGTCATGTCA
ATGTCGTAACGCGTCGTACGACGAGCACCATCGGCACGCGCTTCCTACAACAACGACAAGAACCACCATCCAAACATCATCAGACCACCCAAAACCCTCG
ATAACCAGCTCCAAGAACAAACTAAGAAACAAAAACAAATAATGAACGAACGAAGAAAAAGAGCTTCGAGACGTACTGCCTCAATCGTAATAGCTTGAGC
AGGACAGATAGCTTCACACAACTTGCAGGCAATGCACCTACACATTCACAGCAACAAGAAAAGCACCAACAAATAAGGGTCCACTGCGTCCACAATGCCT
TCATAACAGCTTCTTTTCTACAGCCAATCAATGCCACGCACCGCTCTTCACCGCTAGGATAGCGACGCAGCGCGTGCTCACCACGGAAGCGCGGACTAAT
CATGCCCTTCTCAAACGGATAATTGATCGTGACCTTGCGCTCCATGTGCACTTCCCACGCCAACCAAGTGGCTCGAAACACGTCCGACAGAAAGAACGTG
TCCGACATCTTCTCAATCACTTCGCTCCACGTCGACTTCGGGTCCTGTTTGCCAGCTGCTGGTACGTTCGAGAGGCCACGAGAGCCGATACTTCCGGCTA
TAGAGTCGACAGCCCTGCAGCGGTTGGTAGCCAGAGCCGCAGCGGCCGATCGACGCAGCTGGAGGATGTTCATTGACCGGGCGTTTTCGGAAATAGCGAA
GTGCGGCTGGGCGTGGTCCCCTCGAACAACGTTCGTGCAACCTGATTCGAAGGCCGAGTTGTGTCGCGTTGCATAGTGTGATGGAATGGAATGAACGGCC
TGGGATTGGAAGGAATTCAGTCGCTATTGACGCTGATGAAGTAGGGTTGTCTGACGAACGGTTTTCATTGGCTACAAACCGTTCGGGGACATCGACCCTG
ATCGAACGTATTATTGTTATTGGGATTGGAATTGATATTGGTATTGTTATTATTGGGATTGGATGGTGTCGAACGCGTTTGTGCTGTGCAAAGTGCGGCA
CAATGTGAGTCTGTTGCCATGTCACAGCATGGAGCCGCGCGTGGGGATTGAGCAGGACCTGGCCGAGCAGCTTATGCACTACTCGGATCCGCTGAAGGGC
GTTATCTTGAGCTTCAGTAACGTGCAGCTGGATCGACCTTACGGCGCTATTGTGAATGAAATGCCGTTTATCCACTGTAAAGTACTGGCTGATGCGCTCG
TGTTCCGTCCTCGGAAAGGCATGGAGCTGCGTGGTATTGTCAATAAGATCGGTAGCAACCACGTCGGAATGCTCTTTGCTGGCGTCTTCAATGGGTCTGT
AGCTGAAGCCGAGCTGCCGAAGGGATACGTACACAACTACGCCCAGGATTGCTGGTACATTGCTGTAGTATAGCTAGTAGCTGTTGTGTTCCTTTGTGGG
TGTAGCGGTGGTACTTAGGCTGTATTTTTCTGTGCTGCAGGCTTGGTGAGGACGGCTCGTCTATTTCCGTGGCGGACGAAGTGGACGTGAAAGTGCTGCG
GTGGGATAAATGCTGCACTCTACATGCTTCTTGCTGTG