Description :
From Genome Similarity Track
Location :
Scaffold_91:37784- 39978
Transcript NameFunction/comments
Physo_140880predicted protein

Sequence
2194 bases(100 bases per row)
GAGCAGTCGCTGCTGGCCAACCTGCGCAAGCGCTACGAGCACGAGCTCATCTACACGTACGTGGGGCCCATCCTCATCGCCATCAACCCGTACCAGCAGC
TGGGCGACGCCTACAGCGAGAAGAAGATGACCGAGTACTACGGCAAGGCCATGGGCATGCTGCCCCCGCACGTCTTCGCGCTGGCCGACCACGCCTACAC
GCAGCTCATCCAGGGCGGCGCGCTGGACCCGGCCAACCAGAGCATCATCATCAGCGGCGAGAGCGGCTCGGGCAAGACCGAGACCACCAAGATCATCATG
CAGTACCTGGCGCGCGCCACGAGCTACCGCAAGGGCCCCGACGGCGAGGGCGTGGCCCCCGTGGACGCCTCCGCGGCCATGTCGGGCGCACTGGGCAAGC
TCGAGGAGCGCGTGCTGGAGAGCAACCCGCTGCTCGAGTCCTTCGGCAACGCCAAGACGCTGCGCAACGACAACTCGAGTCGCTTCGGCAAGTTCATCGA
GATCCAGTTCAACCACCACGGCAAGATCGTGGGCGCGCAGATCCTCAACTTCCTGCTGGAGAAGACGCGCATCGTGTCGCAAAGCTTGGGCGAGCGCAAC
TACCACATCTTCTACCAGCTGCTGGCGGGCGCGGACAACGCGCTGCGCGAGCGCCTGCAGCTCAAGACGCCGCACGACTACGAGTACCTGCGCAAGAGCG
AGTGCTTCAGCATCCACTCGTGCGACGACGCCAAGGAGTTCGCCACTACCAAGAGGTGCATGGAGACCATTGGGATCACGGAGGACAGGCAGGAGATGGT
GTTCGAGCTGCTCGCGGCCGTGCTGCAGCTCGGCAACTTGCAGTTCGCTATGGAGAACGACACATGCGTGACCGTCGGCGACGACTCGGCCAATGGCATG
AAGCTCGTGGCGTCGCTGCTCAAGGTGAGCGAGGACGCGCTGTCCAAGGCGCTGCTGACGCGCCAGCTTTACGTGGGCGGCAAGGTCATCGTGCAGCAGC
AGAACTCGGAGCAGGTGCGCGACAAGCGCGACGCGCTGGCCAAGGGCATCTACTCGTCGCTCTTTCTGTGGCTCGTGTCCGAGCTGAACCGCACGATCTC
GCGCAACCAAGAGAAGTGGGGCTTCATCGGCGTGCTGGATATCTACGGCTTCGAGAAGTTTGAGTGGAACACGTTCGAGCAGCTGTGCATCAACTACGCC
AACGAGAAGCTCCAGCGACACTTCAACCAGCACATGCTCGAGGTGGAGCAGAACGACTACGCGAAGGAGGGCATCGACTGGAAGCACATTGACTTCGAGG
ACAACCAGGAGTGTCTGGACCTGATCGAGAGCAAGGTGAACGGCAAGCCCGGCATCTTCATCTCGCTGGACGACAACTGGCGGCTCAAGGGCGAAGAGGC
CAACAAGAAGTTCGTGTCGAACCTGCACAACTCGTTCGGTCGCACGTCCAGCGGACACTCGAGCAGCAAGAACAAGTTCTATGTGCACCCGAAGATGGAC
GCGGACTTGCACTTTGGCATCAAGCACTACGCCGGCGAGGTGATCTACGACGCCAGCGGCTTCAACGACAAGAACAATGAGACGTTGAACGACGACATGA
AGGAGCTCATCCGACAGTCCAAGAGCGACTGGCTTCGCGGAATCTTTGACCTGAACATGCAGTCGATCGAGGCCATTCCTGGCAACAAGCCGCAGCAACA
GCACTCGATCTCTCGGCGCCCGAATGAGATGAAGGGCAAGGGAGCACATCAGCAGGGAAATAAGTCGCGCAACATCCGCGAGGTGTCTGTGAGCGCCCAG
TTCCGGTACCAGCTCCAGGAGCTCATGGGCAAGATTTCTCTCGCAAACCCTCGGTATGTGCGTTGCATCAAGCCGAACGAGTTCAAGCGTCCGAGCGAGC
TTAACGACCAGGACTGCGCGCGTCAGCTCAAATACTCCGGTATGATGGAGGCGATTCAGATCCGTCAGCGTGGTTTCGCTCTGCGTGAGGACCACGACGT
GTTCTTTTACGACTACCAGTCTCTCGCGCCTGACGCTGAGAACGTCAAGGAGCTTGTGGAGGAAATCTCGTCTATGCTGGGTGCAGGTAAGGAAGAGTGG
CAGCTGGGCAAGACGAAGGTGTTCCTGAAGAGGGCCATGGCGTTCAAGTTGCGAAAGCTGGAGGTGCTGCGGTGCAAGTCTGCCGCACGTGCTA