Description :
From Genome Similarity Track
Location :
Scaffold_15:37782- 39004
Transcript NameFunction/comments
Physo_343537Hypothetical protein

Sequence
1222 bases(100 bases per row)
AGGCCACGCAGGAGGCGGTGTGGCTCAAGGTGTTTCTGTGCGAGCTAGGCGAGATGGCGAGCGACGAAGCGGTGAAGATCTACGAGGACAACCAAGGCTC
CATCGCGTTGGCCAAGAACCCGGAGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTG
TTGCAGTATGTTTCGACACTCGACATGCTGGCGGACATCAATGACGAAGCCGATCGCGGCGCCGCAGTTCGACGCGCTCAGGACGAAGCTGGGCATCGTG
GTCGCTGACGAGTCGAGTGGGAGTGTTGTCAAGACTGATGTGACGACGCCTCGCCAAGCGACCGTGTGACGCGAACGCGTCATCAGTGAGGTCGGCGTGA
CCTTCACTGTGTTGTACCGCAATCATTCAGGTGATTACGGGACGATGATTACGTCACGGTGATTACGCCAAGATTGTGGGTACAAGATGGGCATCGACGT
GGCGTTCTCTGATTGGATAAGGTAACTGTGTATCCAGTAGAGAATCCAGTAGGGTGTATCCAGTAAGAGGTATCCAGTAGCAGGCTTAGAGGTAGCACGC
GGTTGCGAACTAAGGACCTGAATCGAATCACTTTGCATTTTGCCAACTACTGCTCAAGTGCTCTTCCTTTTGTATCTACTAGCAGTAGTAGGTATTGCCA
TGACCCGCAACAACTTGTCAATCTAGATATGGTTGCATTATTTGTCCACGCGCATTACATGACCATGGCTAGCAAATATTCTAATAGCATTAAAGGAATT
ATTGTACATGAACGACCCTAACTGTGCATCTAGCTGTAGTTCTACCAGTTCATCCGTCCGCACGCCGCCACGCTGAGCAGCCTGTCCAGCAACAAGCAGG
CGAACGGAGCAAACCGCTGCGACCCGTAGGGGTACGCGTTGATGTCCTTGGCCACGAACATCTCGCAGAACGTGTCGAACGCGCACGACGCGTCGGATAT
GAGCGGCAAGCGCACGAGCATGATGACGCGCGACTGCTTGCCGGCCGCGATCGTGTCGTACGCGTCCTGGCGCGCCACCTTCGCCACATTGGGCATCCCG
TCGTAGGCGGCCGCGCAGCACCTCGTCCGCGCTGAGCCTGAAGTCGCCGATCTTGCACGCGATGCAGCAGTTCTTGCGCTGCTGCTCACGGTCGTCCACG
TATAGCGCGCCCAGGTGCTGCT